Transcript: Human NM_006108.4

Homo sapiens spondin 1 (SPON1), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SPON1 (10418)
Length:
5052
CDS:
183..2606

Additional Resources:

NCBI RefSeq record:
NM_006108.4
NBCI Gene record:
SPON1 (10418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116981 CAGAGTTGTCATCGAGAGAAT pLKO.1 1385 CDS 100% 4.950 6.930 N SPON1 n/a
2 TRCN0000300421 CAGAGTTGTCATCGAGAGAAT pLKO_005 1385 CDS 100% 4.950 6.930 N SPON1 n/a
3 TRCN0000116979 GCCAAGTACAGACTCACATTT pLKO.1 795 CDS 100% 13.200 10.560 N SPON1 n/a
4 TRCN0000300420 GCCAAGTACAGACTCACATTT pLKO_005 795 CDS 100% 13.200 10.560 N SPON1 n/a
5 TRCN0000116978 CCTGACAATGTCGATGATATT pLKO.1 1437 CDS 100% 13.200 9.240 N SPON1 n/a
6 TRCN0000300419 CCTGACAATGTCGATGATATT pLKO_005 1437 CDS 100% 13.200 9.240 N SPON1 n/a
7 TRCN0000116977 GCTGGATTATTTGCTTGTTTA pLKO.1 2658 3UTR 100% 13.200 9.240 N SPON1 n/a
8 TRCN0000300418 GCTGGATTATTTGCTTGTTTA pLKO_005 2658 3UTR 100% 13.200 9.240 N SPON1 n/a
9 TRCN0000116980 GCAGAACTTGGAGACTGCAAT pLKO.1 2115 CDS 100% 4.950 2.970 N SPON1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07603 pDONR223 100% 99.9% 100% None 864A>G n/a
2 ccsbBroad304_07603 pLX_304 0% 99.9% 100% V5 864A>G n/a
3 TRCN0000477549 ACGCCGGAACTGGTCTCCTGACCT pLX_317 18.1% 99.9% 100% V5 864A>G n/a
Download CSV