Transcript: Human NM_006134.7

Homo sapiens transmembrane protein 50B (TMEM50B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM50B (757)
Length:
2332
CDS:
179..655

Additional Resources:

NCBI RefSeq record:
NM_006134.7
NBCI Gene record:
TMEM50B (757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006134.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126902 AGCACTCTGATCTACAAATTT pLKO.1 608 CDS 100% 15.000 10.500 N Tmem50b n/a
2 TRCN0000326596 AGCACTCTGATCTACAAATTT pLKO_005 608 CDS 100% 15.000 10.500 N Tmem50b n/a
3 TRCN0000134577 GTTGATGTTTGGGTCACTTAT pLKO.1 490 CDS 100% 13.200 9.240 N TMEM50B n/a
4 TRCN0000137409 GCATCTGTTGTCGCAGGTATA pLKO.1 254 CDS 100% 10.800 7.560 N TMEM50B n/a
5 TRCN0000349716 GCATCTGTTGTCGCAGGTATA pLKO_005 254 CDS 100% 10.800 7.560 N TMEM50B n/a
6 TRCN0000133761 CTTATTGCTTCCATGTGGATT pLKO.1 506 CDS 100% 4.950 3.465 N TMEM50B n/a
7 TRCN0000312453 CTTATTGCTTCCATGTGGATT pLKO_005 506 CDS 100% 4.950 3.465 N TMEM50B n/a
8 TRCN0000135932 GTATCCTAAGCCAGAACAGTT pLKO.1 319 CDS 100% 4.950 3.465 N TMEM50B n/a
9 TRCN0000312390 GTATCCTAAGCCAGAACAGTT pLKO_005 319 CDS 100% 4.950 3.465 N TMEM50B n/a
10 TRCN0000135989 GTATTGACTGGAGTGAGAGAA pLKO.1 222 CDS 100% 4.950 3.465 N TMEM50B n/a
11 TRCN0000137154 GAAGAACCGAAGAGCTATGGA pLKO.1 630 CDS 100% 3.000 2.100 N TMEM50B n/a
12 TRCN0000312392 GAAGAACCGAAGAGCTATGGA pLKO_005 630 CDS 100% 3.000 2.100 N TMEM50B n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 998 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1162 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006134.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00196 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00196 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477700 TTATACCGTTAGTGTGGATGTCCA pLX_317 72% 100% 100% V5 n/a
Download CSV