Transcript: Human NM_006160.4

Homo sapiens neuronal differentiation 2 (NEUROD2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NEUROD2 (4761)
Length:
3030
CDS:
199..1347

Additional Resources:

NCBI RefSeq record:
NM_006160.4
NBCI Gene record:
NEUROD2 (4761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019910 GAATCTCTTGTCTTACGATAT pLKO.1 1266 CDS 100% 10.800 15.120 N NEUROD2 n/a
2 TRCN0000234854 GAATCTCTTGTCTTACGATAT pLKO_005 1266 CDS 100% 10.800 15.120 N NEUROD2 n/a
3 TRCN0000019913 CTACCACTACTCTATGCACTA pLKO.1 1164 CDS 100% 4.050 5.670 N NEUROD2 n/a
4 TRCN0000019909 CCCTCTTTCTTGAAGAGGGTA pLKO.1 1803 3UTR 100% 0.264 0.211 N NEUROD2 n/a
5 TRCN0000234855 CAATCAGTGACTCGGAGATTT pLKO_005 2340 3UTR 100% 13.200 9.240 N NEUROD2 n/a
6 TRCN0000019912 GCGCCTAGCCAAGAACTATAT pLKO.1 687 CDS 100% 13.200 9.240 N NEUROD2 n/a
7 TRCN0000234853 GCGCCTAGCCAAGAACTATAT pLKO_005 687 CDS 100% 13.200 9.240 N NEUROD2 n/a
8 TRCN0000257234 CCATGTACGAGGAGCTCAATG pLKO_005 1310 CDS 100% 10.800 7.560 N NEUROD2 n/a
9 TRCN0000238797 CAGCTCAACTCTCGCAACTTC pLKO_005 823 CDS 100% 4.950 3.465 N NEUROD2 n/a
10 TRCN0000019911 GCTCTGTCTCAATGGCAACTT pLKO.1 1104 CDS 100% 4.950 3.465 N NEUROD2 n/a
11 TRCN0000081827 GATATGCACCTTCACCACGAT pLKO.1 1282 CDS 100% 2.640 3.696 N Neurod2 n/a
12 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 454 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06633 pDONR223 100% 99.8% 99.7% None 310C>G;816C>A n/a
2 ccsbBroad304_06633 pLX_304 0% 99.8% 99.7% V5 310C>G;816C>A n/a
3 TRCN0000475946 GTACGAGAATTTCTCACTGTAGCC pLX_317 24.5% 99.6% 98.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV