Transcript: Human NM_006189.1

Homo sapiens olfactory marker protein (OMP), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
OMP (4975)
Length:
492
CDS:
1..492

Additional Resources:

NCBI RefSeq record:
NM_006189.1
NBCI Gene record:
OMP (4975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005239 AGGACTCGGATGCCATAGATT pLKO.1 329 CDS 100% 5.625 3.938 N OMP n/a
2 TRCN0000005240 CTACAGTTCGAGCGCTGGAAT pLKO.1 187 CDS 100% 4.950 3.465 N OMP n/a
3 TRCN0000005241 CATAGATTGGAATGAGGCCGA pLKO.1 342 CDS 100% 0.540 0.378 N OMP n/a
4 TRCN0000005243 CGGAGTCTGTGTACCGCCTCA pLKO.1 146 CDS 100% 0.000 0.000 N OMP n/a
5 TRCN0000005242 GCTACGCGTGGAGAGCCTGAA pLKO.1 78 CDS 100% 0.000 0.000 N OMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01119 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01119 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471404 ACGCCTGTCAATATACCCGGCATC pLX_317 77.2% 100% 100% V5 n/a
Download CSV