Transcript: Human NM_006208.3

Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ENPP1 (5167)
Length:
7438
CDS:
17..2794

Additional Resources:

NCBI RefSeq record:
NM_006208.3
NBCI Gene record:
ENPP1 (5167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002537 CGTGCATAGAACCAGAACATA pLKO.1 432 CDS 100% 5.625 7.875 N ENPP1 n/a
2 TRCN0000002539 CATGGGTTGAAGAATTGTTAA pLKO.1 2643 CDS 100% 13.200 9.240 N ENPP1 n/a
3 TRCN0000002541 GCTCATGTAACCCTTCGATTT pLKO.1 1893 CDS 100% 10.800 7.560 N ENPP1 n/a
4 TRCN0000002540 CTGCGAAAGTATGCTGAAGAA pLKO.1 2357 CDS 100% 4.950 3.465 N ENPP1 n/a
5 TRCN0000002538 TGAGGGACGATCTTTGAATAT pLKO.1 3435 3UTR 100% 13.200 7.920 N ENPP1 n/a
6 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6816 3UTR 100% 10.800 5.400 Y MRPS16 n/a
7 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6816 3UTR 100% 10.800 5.400 Y CD3EAP n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6494 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6494 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006208.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13918 pDONR223 100% 94.3% 36.2% None 1_156del;1162G>T;2762T>G n/a
2 ccsbBroad304_13918 pLX_304 0% 94.3% 36.2% V5 (not translated due to prior stop codon) 1_156del;1162G>T;2762T>G n/a
3 TRCN0000476126 GGAGCGGGATGCTAGAAGAAGTCC pLX_317 16.9% 94.3% 36.2% V5 (not translated due to prior stop codon) 1_156del;1162G>T;2762T>G n/a
Download CSV