Transcript: Human NM_006349.3

Homo sapiens zinc finger HIT-type containing 1 (ZNHIT1), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ZNHIT1 (10467)
Length:
728
CDS:
32..496

Additional Resources:

NCBI RefSeq record:
NM_006349.3
NBCI Gene record:
ZNHIT1 (10467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197290 GATGCGGACACTGGAAAGAAA pLKO.1 212 CDS 100% 5.625 3.938 N ZNHIT1 n/a
2 TRCN0000323206 GATGCGGACACTGGAAAGAAA pLKO_005 212 CDS 100% 5.625 3.938 N ZNHIT1 n/a
3 TRCN0000163169 GAGACTGCCTCAGTTTGATGA pLKO.1 190 CDS 100% 4.950 3.465 N ZNHIT1 n/a
4 TRCN0000323135 GAGACTGCCTCAGTTTGATGA pLKO_005 190 CDS 100% 4.950 3.465 N ZNHIT1 n/a
5 TRCN0000161101 GAATGACAACTTCCAGGATGA pLKO.1 139 CDS 100% 4.050 2.835 N ZNHIT1 n/a
6 TRCN0000164544 CCTGGAGAATGACAACTTCCA pLKO.1 133 CDS 100% 2.640 1.848 N ZNHIT1 n/a
7 TRCN0000161467 GAGAATGACAACTTCCAGGAT pLKO.1 137 CDS 100% 2.640 1.848 N ZNHIT1 n/a
8 TRCN0000186657 GCCTTCAGAAAGACAGAATTT pLKO.1 540 3UTR 100% 13.200 7.920 N ZNHIT1 n/a
9 TRCN0000323137 GCCTTCAGAAAGACAGAATTT pLKO_005 540 3UTR 100% 13.200 7.920 N ZNHIT1 n/a
10 TRCN0000323208 TGTTGGAGGAGCAGAACTTGA pLKO_005 291 CDS 100% 4.950 2.970 N ZNHIT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02444 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02444 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470999 GGGTACAAGGTCCCCCCTGGCCTT pLX_317 92.5% 100% 100% V5 n/a
Download CSV