Transcript: Human NM_006366.3

Homo sapiens cyclase associated actin cytoskeleton regulatory protein 2 (CAP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CAP2 (10486)
Length:
2925
CDS:
154..1587

Additional Resources:

NCBI RefSeq record:
NM_006366.3
NBCI Gene record:
CAP2 (10486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222717 GAGCGCCAAGTCATCTGAAAT pLKO.1 1452 CDS 100% 13.200 18.480 N CAP2 n/a
2 TRCN0000078390 CGCTCAGCTTTATTTGCCCAA pLKO.1 931 CDS 100% 2.160 3.024 N CAP2 n/a
3 TRCN0000414037 CAACTCCCAGGACATTCAAAT pLKO_005 1338 CDS 100% 13.200 9.240 N CAP2 n/a
4 TRCN0000434689 CATGGGATGGATCCAAGTTAA pLKO_005 1538 CDS 100% 13.200 9.240 N CAP2 n/a
5 TRCN0000078392 CCAAACTTTCAGAGAGAGAAA pLKO.1 504 CDS 100% 4.950 3.465 N CAP2 n/a
6 TRCN0000078389 CCTAAATCTTATCCTTCTCAA pLKO.1 1090 CDS 100% 4.950 3.465 N CAP2 n/a
7 TRCN0000078388 CCTTTGAGAATCTAAGATGTA pLKO.1 1953 3UTR 100% 4.950 3.465 N CAP2 n/a
8 TRCN0000105909 CCATTAATAAGACAGAAGGAT pLKO.1 1388 CDS 100% 3.000 2.100 N Cap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07620 pDONR223 100% 99.9% 100% None 1137A>G n/a
2 ccsbBroad304_07620 pLX_304 0% 99.9% 100% V5 1137A>G n/a
3 TRCN0000479692 ATAACACCATCGCCAGTTGTGTCT pLX_317 24.7% 99.9% 100% V5 1137A>G n/a
Download CSV