Transcript: Human NM_006559.3

Homo sapiens KH RNA binding domain containing, signal transduction associated 1 (KHDRBS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KHDRBS1 (10657)
Length:
2713
CDS:
129..1460

Additional Resources:

NCBI RefSeq record:
NM_006559.3
NBCI Gene record:
KHDRBS1 (10657)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428104 ACCCACAACAGACAAGTAATT pLKO_005 1541 3UTR 100% 13.200 18.480 N KHDRBS1 n/a
2 TRCN0000428752 ACGAAGGCTACGAAGGCTATT pLKO_005 1267 CDS 100% 10.800 15.120 N KHDRBS1 n/a
3 TRCN0000000045 GTACCGGATATGATGGATGAT pLKO.1 894 CDS 100% 0.000 0.000 N KHDRBS1 n/a
4 TRCN0000421706 GTATTGGGAAAGGGCTCAATG pLKO_005 717 CDS 100% 10.800 7.560 N KHDRBS1 n/a
5 TRCN0000000047 CCACAAGGGAATACAATCAAA pLKO.1 663 CDS 100% 5.625 3.938 N KHDRBS1 n/a
6 TRCN0000000044 GTTCCCAAGTTAGTCAAGTAT pLKO.1 2465 3UTR 100% 5.625 3.938 N KHDRBS1 n/a
7 TRCN0000000046 GACGGCAGAAATTGAGAAGAT pLKO.1 503 CDS 100% 4.950 3.465 N KHDRBS1 n/a
8 TRCN0000102324 GCATGTCTTCATTGAAGTCTT pLKO.1 809 CDS 100% 4.950 3.465 N Khdrbs1 n/a
9 TRCN0000326088 GCATGTCTTCATTGAAGTCTT pLKO_005 809 CDS 100% 4.950 3.465 N Khdrbs1 n/a
10 TRCN0000000048 GATGAGGAGAATTACTTGGAT pLKO.1 549 CDS 100% 3.000 2.100 N KHDRBS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.