Transcript: Human NM_006700.3

Homo sapiens TRAF-type zinc finger domain containing 1 (TRAFD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TRAFD1 (10906)
Length:
2633
CDS:
72..1820

Additional Resources:

NCBI RefSeq record:
NM_006700.3
NBCI Gene record:
TRAFD1 (10906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004987 GTCTGTCAGTAACGAGGCTTT pLKO.1 2320 3UTR 100% 4.050 5.670 N TRAFD1 n/a
2 TRCN0000280062 GTCTGTCAGTAACGAGGCTTT pLKO_005 2320 3UTR 100% 4.050 5.670 N TRAFD1 n/a
3 TRCN0000004988 CCTACCTGTAAGGAACCATTT pLKO.1 189 CDS 100% 10.800 8.640 N TRAFD1 n/a
4 TRCN0000004991 CCAGGTCTCTCAGTGACATAA pLKO.1 898 CDS 100% 13.200 9.240 N TRAFD1 n/a
5 TRCN0000280059 CCAGGTCTCTCAGTGACATAA pLKO_005 898 CDS 100% 13.200 9.240 N TRAFD1 n/a
6 TRCN0000004990 CCCAGGTTTCAATTCAGAATA pLKO.1 688 CDS 100% 13.200 7.920 N TRAFD1 n/a
7 TRCN0000279992 CCCAGGTTTCAATTCAGAATA pLKO_005 688 CDS 100% 13.200 7.920 N TRAFD1 n/a
8 TRCN0000004989 GCATCATTATCCCATGTGAAT pLKO.1 1165 CDS 100% 4.950 2.970 N TRAFD1 n/a
9 TRCN0000279993 GCATCATTATCCCATGTGAAT pLKO_005 1165 CDS 100% 4.950 2.970 N TRAFD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02554 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02554 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469645 GTTCTCGCCGCTTACTCTCCGAAG pLX_317 23.7% 100% 100% V5 n/a
Download CSV