Transcript: Human NM_006796.3

Homo sapiens AFG3 like matrix AAA peptidase subunit 2 (AFG3L2), mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
AFG3L2 (10939)
Length:
3160
CDS:
146..2539

Additional Resources:

NCBI RefSeq record:
NM_006796.3
NBCI Gene record:
AFG3L2 (10939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421434 GCTAGAGTCCGAGACTTATTT pLKO_005 1304 CDS 100% 15.000 21.000 N AFG3L2 n/a
2 TRCN0000051488 CGGACGCTTTACCGATTTGTT pLKO.1 254 CDS 100% 5.625 7.875 N AFG3L2 n/a
3 TRCN0000412514 GCAATACGTTTGGTTTAATAT pLKO_005 772 CDS 100% 15.000 10.500 N AFG3L2 n/a
4 TRCN0000241174 CTTTGTCAATAACTATCTTTC pLKO_005 667 CDS 100% 10.800 7.560 N Afg3l2 n/a
5 TRCN0000051489 GCCAAGGTCTTAAAGGATGAA pLKO.1 1031 CDS 100% 4.950 3.465 N AFG3L2 n/a
6 TRCN0000051490 GCATCTTTAACTCCAGGGTTT pLKO.1 1673 CDS 100% 4.050 2.835 N AFG3L2 n/a
7 TRCN0000051492 GCCAAGCTAGAGATCATGGAA pLKO.1 1091 CDS 100% 3.000 1.800 N AFG3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07709 pDONR223 100% 99.9% 100% None 1389G>A;1650A>G n/a
2 ccsbBroad304_07709 pLX_304 0% 99.9% 100% V5 1389G>A;1650A>G n/a
3 TRCN0000476795 CACCGGTGCGAAGTCTACCAGCGG pLX_317 14.1% 99.9% 100% V5 1389G>A;1650A>G n/a
Download CSV