Transcript: Human NM_006815.4

Homo sapiens transmembrane p24 trafficking protein 2 (TMED2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TMED2 (10959)
Length:
2544
CDS:
86..691

Additional Resources:

NCBI RefSeq record:
NM_006815.4
NBCI Gene record:
TMED2 (10959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006815.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065307 GAGCCATCAACGACAACACAA pLKO.1 561 CDS 100% 4.950 6.930 N TMED2 n/a
2 TRCN0000289255 GAGCCATCAACGACAACACAA pLKO_005 561 CDS 100% 4.950 6.930 N TMED2 n/a
3 TRCN0000065305 CTCGGGCTATTTCGTTAGCAT pLKO.1 139 CDS 100% 3.000 4.200 N TMED2 n/a
4 TRCN0000289257 CTCGGGCTATTTCGTTAGCAT pLKO_005 139 CDS 100% 3.000 4.200 N TMED2 n/a
5 TRCN0000065306 ACATGGATGGAACATACAAAT pLKO.1 339 CDS 100% 13.200 9.240 N TMED2 n/a
6 TRCN0000289258 ACATGGATGGAACATACAAAT pLKO_005 339 CDS 100% 13.200 9.240 N TMED2 n/a
7 TRCN0000065304 AGGACCAGATAACAAAGGAAT pLKO.1 271 CDS 100% 4.950 3.465 N TMED2 n/a
8 TRCN0000289329 AGGACCAGATAACAAAGGAAT pLKO_005 271 CDS 100% 4.950 3.465 N TMED2 n/a
9 TRCN0000065303 GCTGTAAAGCACGAACAGGAA pLKO.1 512 CDS 100% 2.640 1.848 N TMED2 n/a
10 TRCN0000289256 GCTGTAAAGCACGAACAGGAA pLKO_005 512 CDS 100% 2.640 1.848 N TMED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006815.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07715 pDONR223 100% 99.8% 100% None 30T>C n/a
2 ccsbBroad304_07715 pLX_304 0% 99.8% 100% V5 30T>C n/a
3 TRCN0000468252 CATCGCAGTGGCCGCTCCATTTTC pLX_317 59.2% 99.8% 100% V5 30T>C n/a
Download CSV