Transcript: Human NM_006825.4

Homo sapiens cytoskeleton associated protein 4 (CKAP4), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
CKAP4 (10970)
Length:
3121
CDS:
170..1978

Additional Resources:

NCBI RefSeq record:
NM_006825.4
NBCI Gene record:
CKAP4 (10970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308168 CGCGGATTTAAAGTCCAATTT pLKO_005 1998 3UTR 100% 13.200 18.480 N CKAP4 n/a
2 TRCN0000296261 CTTGAGAAGCTCCCAACATAA pLKO_005 694 CDS 100% 13.200 10.560 N CKAP4 n/a
3 TRCN0000308165 TGGAATCAGCCAAGGGTTTAC pLKO_005 1890 CDS 100% 10.800 8.640 N CKAP4 n/a
4 TRCN0000123295 GCAGGATTTGAAAGCCTTAAA pLKO.1 1018 CDS 100% 13.200 9.240 N CKAP4 n/a
5 TRCN0000289520 GCAGGATTTGAAAGCCTTAAA pLKO_005 1018 CDS 100% 13.200 9.240 N CKAP4 n/a
6 TRCN0000123296 GCAAGCCACATTTGGAACTTT pLKO.1 664 CDS 100% 5.625 3.938 N CKAP4 n/a
7 TRCN0000123297 CTCCAGAATGAGATTCTCAAA pLKO.1 788 CDS 100% 4.950 3.465 N CKAP4 n/a
8 TRCN0000123298 CTGGATAGGTTGTTTGTGAAA pLKO.1 1931 CDS 100% 4.950 3.465 N CKAP4 n/a
9 TRCN0000289521 CTGGATAGGTTGTTTGTGAAA pLKO_005 1931 CDS 100% 4.950 3.465 N CKAP4 n/a
10 TRCN0000123294 CCTGTGAATAACAGGTGGCTT pLKO.1 2202 3UTR 100% 0.264 0.185 N CKAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14982 pDONR223 93.8% 99.7% 99.6% None (many diffs) n/a
2 ccsbBroad304_14982 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
3 TRCN0000477309 ACGAAGACCGATTTCTCGTACGCG pLX_317 20.2% 99.7% 99.6% V5 (many diffs) n/a
Download CSV