Transcript: Human NM_006856.3

Homo sapiens activating transcription factor 7 (ATF7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ATF7 (11016)
Length:
6660
CDS:
126..1577

Additional Resources:

NCBI RefSeq record:
NM_006856.3
NBCI Gene record:
ATF7 (11016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274349 GCTAGATTTGATGACATATTA pLKO_005 2013 3UTR 100% 15.000 10.500 N ATF7 n/a
2 TRCN0000017113 GCCGATACAATCGCATGTAAT pLKO.1 1523 CDS 100% 13.200 6.600 Y ATF7 n/a
3 TRCN0000274293 TATCCCTGGCCCACCAGTTAA pLKO_005 824 CDS 100% 13.200 6.600 Y ATF7 n/a
4 TRCN0000274291 ACCAAGTCTCCTCAATCAATG pLKO_005 922 CDS 100% 10.800 5.400 Y ATF7 n/a
5 TRCN0000086247 CAGTCATCATTGCAGATCAAA pLKO.1 256 CDS 100% 5.625 2.813 Y Atf7 n/a
6 TRCN0000017114 CCGAACTGACTCAGTCATCAT pLKO.1 245 CDS 100% 4.950 2.475 Y ATF7 n/a
7 TRCN0000274351 CCGAACTGACTCAGTCATCAT pLKO_005 245 CDS 100% 4.950 2.475 Y ATF7 n/a
8 TRCN0000017116 CGAAGAACTCACTTCTCAGAA pLKO.1 1217 CDS 100% 4.950 2.475 Y ATF7 n/a
9 TRCN0000274294 CGAAGAACTCACTTCTCAGAA pLKO_005 1217 CDS 100% 4.950 2.475 Y ATF7 n/a
10 TRCN0000017117 GAAGTCACATTACTACGCAAT pLKO.1 1254 CDS 100% 4.050 2.025 Y ATF7 n/a
11 TRCN0000017115 GCAGTTCATAAACACAAGCAT pLKO.1 198 CDS 100% 3.000 1.500 Y ATF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15736 pDONR223 0% 22.3% 17.5% None (many diffs) n/a
2 ccsbBroad304_15736 pLX_304 0% 22.3% 17.5% V5 (many diffs) n/a
3 TRCN0000492204 CCGAACACCCTCTAACTCGGCCTC pLX_317 100% 22.3% 17.5% V5 (many diffs) n/a
Download CSV