Transcript: Human NM_006872.5

Homo sapiens general transcription factor IIA subunit 1 like (GTF2A1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
GTF2A1L (11036)
Length:
1618
CDS:
20..1456

Additional Resources:

NCBI RefSeq record:
NM_006872.5
NBCI Gene record:
GTF2A1L (11036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006872.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421051 CATCCAATTCAGCAAGTATTT pLKO_005 476 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
2 TRCN0000427465 GACCTGTTTGACACGGATAAT pLKO_005 1304 CDS 100% 13.200 6.600 Y STON1-GTF2A1L n/a
3 TRCN0000017379 GCATCCAATTCAGCAAGTATT pLKO.1 475 CDS 100% 13.200 6.600 Y GTF2A1L n/a
4 TRCN0000428394 TATTGTCTGTCAGTATGATAA pLKO_005 1327 CDS 100% 13.200 6.600 Y GTF2A1L n/a
5 TRCN0000418300 TGAAGGAGTTCGGAATCTATT pLKO_005 76 CDS 100% 13.200 6.600 Y GTF2A1L n/a
6 TRCN0000422368 AGTAGATGGAAGCGGTGATAC pLKO_005 1063 CDS 100% 10.800 5.400 Y GTF2A1L n/a
7 TRCN0000421861 GTGCTACAGCAACCCGCAATT pLKO_005 596 CDS 100% 10.800 5.400 Y GTF2A1L n/a
8 TRCN0000017380 GCAATCGTCAACAGCATCATT pLKO.1 253 CDS 100% 5.625 2.813 Y GTF2A1L n/a
9 TRCN0000018010 CGAAGCAAGAACAAATGGAAA pLKO.1 1355 CDS 100% 4.950 2.475 Y STON1-GTF2A1L n/a
10 TRCN0000017382 GAAGGTATAGAGGAACAAGTT pLKO.1 104 CDS 100% 4.950 2.475 Y GTF2A1L n/a
11 TRCN0000017378 GCCAGTAGATAGGAAACACTT pLKO.1 628 CDS 100% 4.950 2.475 Y GTF2A1L n/a
12 TRCN0000017381 CAGACCTGTTTGACACGGATA pLKO.1 1302 CDS 100% 4.050 2.025 Y GTF2A1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006872.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02603 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02603 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481558 GCATATTCAGAGCCCGACATATGC pLX_317 5.6% 100% 100% V5 n/a
Download CSV