Transcript: Human NM_006891.4

Homo sapiens crystallin gamma D (CRYGD), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CRYGD (1421)
Length:
642
CDS:
52..576

Additional Resources:

NCBI RefSeq record:
NM_006891.4
NBCI Gene record:
CRYGD (1421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083938 CCGCTTCCGCTTCAATGAAAT pLKO.1 393 CDS 100% 13.200 10.560 N CRYGD n/a
2 TRCN0000083940 CAGAGGCCAGATGATAGAGTT pLKO.1 345 CDS 100% 4.950 3.465 N CRYGD n/a
3 TRCN0000097974 GATGCTCTATGAGCAGCCCAA pLKO.1 180 CDS 100% 2.160 1.512 N Cryge n/a
4 TRCN0000083942 GAGCTGTCCAACTACCGAGGA pLKO.1 454 CDS 100% 0.720 0.504 N CRYGD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06046 pDONR223 100% 99.6% 100% None 51T>C;285A>G n/a
2 ccsbBroad304_06046 pLX_304 0% 99.6% 100% V5 51T>C;285A>G n/a
3 TRCN0000467967 ACCCATGAACGGTCAAGAAATGTT pLX_317 66.2% 99.6% 100% V5 51T>C;285A>G n/a
Download CSV