Transcript: Human NM_006917.5

Homo sapiens retinoid X receptor gamma (RXRG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RXRG (6258)
Length:
1966
CDS:
234..1625

Additional Resources:

NCBI RefSeq record:
NM_006917.5
NBCI Gene record:
RXRG (6258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006917.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338809 CTACACGTGTCGGGATAATAA pLKO_005 749 CDS 100% 15.000 21.000 N RXRG n/a
2 TRCN0000350934 TGCGAGCCATTGTACTCTTTA pLKO_005 1345 CDS 100% 13.200 18.480 N RXRG n/a
3 TRCN0000021639 CGGGATTGGAAACATGAACTA pLKO.1 590 CDS 100% 4.950 6.930 N RXRG n/a
4 TRCN0000338807 CGGGATTGGAAACATGAACTA pLKO_005 590 CDS 100% 4.950 6.930 N RXRG n/a
5 TRCN0000338870 ATGACCCTGTTACCAACATAT pLKO_005 1021 CDS 100% 13.200 9.240 N RXRG n/a
6 TRCN0000021643 GCGAGCCATTGTACTCTTTAA pLKO.1 1346 CDS 100% 13.200 9.240 N RXRG n/a
7 TRCN0000021641 GCCTACACCAAGCAGAAGTAT pLKO.1 1440 CDS 100% 5.625 3.938 N RXRG n/a
8 TRCN0000338808 GCCTACACCAAGCAGAAGTAT pLKO_005 1440 CDS 100% 5.625 3.938 N RXRG n/a
9 TRCN0000021642 CTATCAGAAGTGCCTTGTCAT pLKO.1 818 CDS 100% 4.950 3.465 N RXRG n/a
10 TRCN0000021640 GAGTCCTAACTGAGCTGGTTT pLKO.1 1279 CDS 100% 4.950 3.465 N RXRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006917.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01470 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01470 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478997 TGAGATGGCGAACCGTTGGAATAG pLX_317 16.8% 100% 100% V5 n/a
Download CSV