Transcript: Human NM_007042.5

Homo sapiens ribonuclease P/MRP subunit p14 (RPP14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RPP14 (11102)
Length:
7770
CDS:
195..569

Additional Resources:

NCBI RefSeq record:
NM_007042.5
NBCI Gene record:
RPP14 (11102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007042.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049896 GTCTGCCTAGAATTTCAAGAT pLKO.1 264 CDS 100% 4.950 3.960 N RPP14 n/a
2 TRCN0000049894 CCTTTGGACATCCTAACCTAT pLKO.1 372 CDS 100% 4.950 2.475 Y RPP14 n/a
3 TRCN0000049893 GCTGCTTATTTCGGCTGTGAA pLKO.1 320 CDS 100% 4.950 2.475 Y RPP14 n/a
4 TRCN0000049897 GCCTTACCTTTGGACATCCTA pLKO.1 366 CDS 100% 3.000 1.500 Y RPP14 n/a
5 TRCN0000049895 GTAGGGAACTAGTATTGGATT pLKO.1 547 CDS 100% 0.000 0.000 Y RPP14 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3636 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1507 3UTR 100% 4.050 2.025 Y P3H4 n/a
8 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1507 3UTR 100% 4.050 2.025 Y ORAI2 n/a
9 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1507 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3504 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3636 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007042.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02620 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02620 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474043 TTCCTGCCAAGCTTAGGTAATTCT pLX_317 83.1% 100% 100% V5 n/a
Download CSV