Transcript: Human NM_007073.4

Homo sapiens blood vessel epicardial substance (BVES), transcript variant A, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
BVES (11149)
Length:
5469
CDS:
88..1170

Additional Resources:

NCBI RefSeq record:
NM_007073.4
NBCI Gene record:
BVES (11149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422552 ACCGATGTGCCTTGGATATAA pLKO_005 347 CDS 100% 15.000 21.000 N BVES n/a
2 TRCN0000151809 CTTTCTGGAATCAGAACCTTT pLKO.1 798 CDS 100% 0.495 0.693 N BVES n/a
3 TRCN0000413202 AGCAGGGAATCTCAAACTTTA pLKO_005 1617 3UTR 100% 13.200 9.240 N BVES n/a
4 TRCN0000433504 TGTTCTTGGGTGTCAACATTT pLKO_005 383 CDS 100% 13.200 9.240 N BVES n/a
5 TRCN0000153493 CAGAAGACTAACTGGACAGTT pLKO.1 513 CDS 100% 4.950 3.465 N BVES n/a
6 TRCN0000153514 CCAACTACTCTTCACCTTCAT pLKO.1 262 CDS 100% 4.950 3.465 N BVES n/a
7 TRCN0000151940 CCAGATTTGTTCAGAAGACTA pLKO.1 502 CDS 100% 4.950 3.465 N BVES n/a
8 TRCN0000152387 GAGAGATACATCATCTGGTTT pLKO.1 200 CDS 100% 4.950 3.465 N BVES n/a
9 TRCN0000153094 GAGAATCAACTGCCATAGGTT pLKO.1 116 CDS 100% 3.000 2.100 N BVES n/a
10 TRCN0000151536 CAGAAGATGATGATGACGTTT pLKO.1 1103 CDS 100% 4.950 2.970 N BVES n/a
11 TRCN0000151376 GTTGGAAATGAGGAACAGTAT pLKO.1 954 CDS 100% 4.950 2.970 N BVES n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1649 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02630 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02630 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465509 CCTGTGTACTCGTGCACAGTCAAC pLX_317 20.1% 100% 100% V5 n/a
4 ccsbBroadEn_11603 pDONR223 100% 80.1% 80% None 1_213del;1025A>G n/a
5 ccsbBroad304_11603 pLX_304 0% 80.1% 80% V5 1_213del;1025A>G n/a
6 TRCN0000465657 GCTCACAGAACCAACCGTATTATC pLX_317 37.4% 80.1% 80% V5 1_213del;1025A>G n/a
Download CSV