Transcript: Human NM_007103.4

Homo sapiens NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NDUFV1 (4723)
Length:
1560
CDS:
70..1464

Additional Resources:

NCBI RefSeq record:
NM_007103.4
NBCI Gene record:
NDUFV1 (4723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007103.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221377 CCCGCCTCATTGAGTTCTATA pLKO.1 1172 CDS 100% 13.200 18.480 N NDUFV1 n/a
2 TRCN0000352918 CCCGCCTCATTGAGTTCTATA pLKO_005 1172 CDS 100% 13.200 18.480 N NDUFV1 n/a
3 TRCN0000221380 GCAGGTCTGATTGGCAAGAAT pLKO.1 604 CDS 100% 5.625 3.938 N NDUFV1 n/a
4 TRCN0000343449 GCAGGTCTGATTGGCAAGAAT pLKO_005 604 CDS 100% 5.625 3.938 N NDUFV1 n/a
5 TRCN0000221378 CGAGATCAAGACATCGGGTTT pLKO.1 303 CDS 100% 4.050 2.835 N NDUFV1 n/a
6 TRCN0000343407 CGAGATCAAGACATCGGGTTT pLKO_005 303 CDS 100% 4.050 2.835 N NDUFV1 n/a
7 TRCN0000221381 CTGAAGGATGAAGACCGGATT pLKO.1 172 CDS 100% 4.050 2.835 N NDUFV1 n/a
8 TRCN0000352917 CTGAAGGATGAAGACCGGATT pLKO_005 172 CDS 100% 4.050 2.835 N NDUFV1 n/a
9 TRCN0000221379 GCAAGCAGATAGAAGGCCATA pLKO.1 1316 CDS 100% 4.050 2.835 N NDUFV1 n/a
10 TRCN0000343450 GCAAGCAGATAGAAGGCCATA pLKO_005 1316 CDS 100% 4.050 2.835 N NDUFV1 n/a
11 TRCN0000041853 CCCAAGTATCTGGTGGTGAAT pLKO.1 397 CDS 100% 4.950 3.465 N Ndufv1 n/a
12 TRCN0000309462 CCCAAGTATCTGGTGGTGAAT pLKO_005 397 CDS 100% 4.950 3.465 N Ndufv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007103.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01075 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01075 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479182 ATACACTATCAGGCATGCCTCGTC pLX_317 31% 100% 100% V5 n/a
4 ccsbBroadEn_15505 pDONR223 0% 98% 98% None 45_71del n/a
5 ccsbBroad304_15505 pLX_304 0% 98% 98% V5 45_71del n/a
Download CSV