Transcript: Human NM_007106.4

Homo sapiens ubiquitin like 3 (UBL3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
UBL3 (5412)
Length:
4317
CDS:
1080..1433

Additional Resources:

NCBI RefSeq record:
NM_007106.4
NBCI Gene record:
UBL3 (5412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284855 TGATAAATTTGCGCCTCATTT pLKO_005 1105 CDS 100% 13.200 18.480 N UBL3 n/a
2 TRCN0000284854 AGCAGGTCAGCAGTCCAAATA pLKO_005 1228 CDS 100% 13.200 9.240 N UBL3 n/a
3 TRCN0000272785 TGTGATGTGATATAGTCTTTG pLKO_005 1449 3UTR 100% 10.800 7.560 N UBL3 n/a
4 TRCN0000007657 CCTCAATTTAGAGTTTGCTAA pLKO.1 3598 3UTR 100% 4.950 3.465 N UBL3 n/a
5 TRCN0000007658 GAGAGAGTAATTGTTGTGTAA pLKO.1 1405 CDS 100% 4.950 3.465 N UBL3 n/a
6 TRCN0000272786 GAGAGAGTAATTGTTGTGTAA pLKO_005 1405 CDS 100% 4.950 3.465 N UBL3 n/a
7 TRCN0000007659 GCAAAGCATGTATATGACAAT pLKO.1 1185 CDS 100% 4.950 3.465 N UBL3 n/a
8 TRCN0000284858 GCAAAGCATGTATATGACAAT pLKO_005 1185 CDS 100% 4.950 3.465 N UBL3 n/a
9 TRCN0000007660 GACTTATTTATCAAGGACGAT pLKO.1 1255 CDS 100% 2.640 1.848 N UBL3 n/a
10 TRCN0000011095 GAGAGACATTACCAGAGCCAA pLKO.1 1351 CDS 100% 2.640 1.848 N UBL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01232 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01232 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480335 TTAGTAATCGGACCCAGGCCCTTA pLX_317 100% 100% 100% V5 n/a
Download CSV