Transcript: Human NM_007211.5

Homo sapiens Ras association domain family member 8 (RASSF8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RASSF8 (11228)
Length:
2664
CDS:
670..1848

Additional Resources:

NCBI RefSeq record:
NM_007211.5
NBCI Gene record:
RASSF8 (11228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007211.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143165 GAAAGACACTTAGCACCTCAT pLKO.1 817 CDS 100% 4.050 5.670 N RASSF8 n/a
2 TRCN0000122298 CGGACTATGGAAAGTGGTCTT pLKO.1 1465 CDS 100% 4.050 3.240 N RASSF8 n/a
3 TRCN0000144419 CAGATGAGTTGAAGAAGCTAA pLKO.1 1157 CDS 100% 4.950 3.465 N RASSF8 n/a
4 TRCN0000145152 GCCAAAGGATTAATGGACATT pLKO.1 1075 CDS 100% 4.950 3.465 N RASSF8 n/a
5 TRCN0000143234 GAAAGTGGTCTTGAAGCAGAA pLKO.1 1474 CDS 100% 4.050 2.835 N RASSF8 n/a
6 TRCN0000140473 GCAAGTCAATCTCCAGCAGTT pLKO.1 1704 CDS 100% 4.050 2.835 N RASSF8 n/a
7 TRCN0000122537 CCTGTTAGGTTACATCTGCTA pLKO.1 2495 3UTR 100% 2.640 1.848 N RASSF8 n/a
8 TRCN0000144820 GCCTCAGATTGACAAATCAAT pLKO.1 1008 CDS 100% 0.563 0.394 N RASSF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007211.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02651 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02651 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473922 GCCCGTTACTCTTGTGCTATACGC pLX_317 46.5% 100% 100% V5 n/a
Download CSV