Transcript: Human NM_007212.4

Homo sapiens ring finger protein 2 (RNF2), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
RNF2 (6045)
Length:
3407
CDS:
95..1105

Additional Resources:

NCBI RefSeq record:
NM_007212.4
NBCI Gene record:
RNF2 (6045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418134 ACGCCACTGTTGATCACTTAT pLKO_005 852 CDS 100% 13.200 18.480 N RNF2 n/a
2 TRCN0000426500 ATGACTACAAAGGAGTGTTTA pLKO_005 278 CDS 100% 13.200 18.480 N RNF2 n/a
3 TRCN0000033696 CGAAGTCTACACAGTGAATTA pLKO.1 221 CDS 100% 13.200 18.480 N RNF2 n/a
4 TRCN0000413188 ATGGCAATTGATCCAGTAATG pLKO_005 734 CDS 100% 10.800 15.120 N RNF2 n/a
5 TRCN0000033695 CCTAGTAACAAACGGACCAAA pLKO.1 668 CDS 100% 4.950 6.930 N RNF2 n/a
6 TRCN0000416109 GTGCACAGACGAGATACATAA pLKO_005 819 CDS 100% 13.200 10.560 N RNF2 n/a
7 TRCN0000421451 GTTTACGCTATTCAAATCTTT pLKO_005 1234 3UTR 100% 5.625 4.500 N RNF2 n/a
8 TRCN0000415683 AGACCCAAGGCTCAAATTTAC pLKO_005 1575 3UTR 100% 13.200 9.240 N RNF2 n/a
9 TRCN0000433603 CCCTTAGAAGTGGCAACAAAG pLKO_005 330 CDS 100% 10.800 7.560 N RNF2 n/a
10 TRCN0000419292 TAAGGCCAGACCCAAACTTTG pLKO_005 393 CDS 100% 10.800 7.560 N RNF2 n/a
11 TRCN0000040580 CCCAATTTGTTTGGATATGTT pLKO.1 247 CDS 100% 5.625 3.938 N Rnf2 n/a
12 TRCN0000033698 GCTGTGAGGTTAGCTTTAGAA pLKO.1 884 CDS 100% 5.625 3.938 N RNF2 n/a
13 TRCN0000040581 CCATGACTACAAAGGAGTGTT pLKO.1 276 CDS 100% 4.950 3.465 N Rnf2 n/a
14 TRCN0000033694 GCACCTACAAAGGAGCACAAA pLKO.1 1082 CDS 100% 4.950 3.465 N RNF2 n/a
15 TRCN0000033697 GCCAGGATCAACAAGCACAAT pLKO.1 479 CDS 100% 4.950 3.465 N RNF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06867 pDONR223 100% 99.9% 99.7% None 4T>A n/a
2 ccsbBroad304_06867 pLX_304 60.1% 99.9% 99.7% V5 4T>A n/a
3 TRCN0000472910 ACACATGAATCGTAACACCCCGGC pLX_317 50.6% 99.9% 99.7% V5 4T>A n/a
4 ccsbBroad304_06753 pLX_304 53.3% 66.7% 49.6% V5 (many diffs) n/a
Download CSV