Transcript: Human NM_007226.3

Homo sapiens neurexophilin 2 (NXPH2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NXPH2 (11249)
Length:
2709
CDS:
150..944

Additional Resources:

NCBI RefSeq record:
NM_007226.3
NBCI Gene record:
NXPH2 (11249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146513 CGCCTGTTTGTTAAACAGTCT pLKO.1 318 CDS 100% 0.264 0.370 N NXPH2 n/a
2 TRCN0000150120 CAGTGTGTATTTCCGACATAA pLKO.1 575 CDS 100% 13.200 9.240 N NXPH2 n/a
3 TRCN0000373153 GTGACTTTCATTCCAACATTA pLKO_005 493 CDS 100% 13.200 9.240 N NXPH2 n/a
4 TRCN0000373154 GTGGAAATGAGGGATACATAT pLKO_005 958 3UTR 100% 13.200 9.240 N NXPH2 n/a
5 TRCN0000373152 GAAACAGCAGATGCGGTAAAG pLKO_005 1336 3UTR 100% 10.800 7.560 N NXPH2 n/a
6 TRCN0000378934 TGGCCAACATCACGGAGATTC pLKO_005 400 CDS 100% 10.800 7.560 N NXPH2 n/a
7 TRCN0000183656 CAAGGTCATTTGCATTTACAT pLKO.1 833 CDS 100% 5.625 3.938 N NXPH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07786 pDONR223 100% 99.7% 99.6% None 219C>T;429T>A n/a
2 ccsbBroad304_07786 pLX_304 0% 99.7% 99.6% V5 219C>T;429T>A n/a
3 TRCN0000473094 CTGTTAGCATGATCTAGTTGAGTG pLX_317 63.8% 99.7% 99.6% V5 219C>T;429T>A n/a
Download CSV