Transcript: Human NM_007231.5

Homo sapiens solute carrier family 6 member 14 (SLC6A14), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC6A14 (11254)
Length:
4536
CDS:
105..2033

Additional Resources:

NCBI RefSeq record:
NM_007231.5
NBCI Gene record:
SLC6A14 (11254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007231.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038303 GTCGGCTTCATCAGAGAATTT pLKO.1 158 CDS 100% 13.200 18.480 N SLC6A14 n/a
2 TRCN0000418242 CATAATTGCCTATAGTCTTTA pLKO_005 506 CDS 100% 13.200 10.560 N SLC6A14 n/a
3 TRCN0000421162 TCGTCTGGCAAGGTGGTATAT pLKO_005 882 CDS 100% 13.200 10.560 N SLC6A14 n/a
4 TRCN0000038299 GCAGCTATACTGGAGCTAGTT pLKO.1 1569 CDS 100% 4.950 3.960 N SLC6A14 n/a
5 TRCN0000429309 GCAATTTCATAGACCTAATTA pLKO_005 1742 CDS 100% 15.000 10.500 N SLC6A14 n/a
6 TRCN0000423734 TAGTTGGAGCAGCACTATTTA pLKO_005 850 CDS 100% 15.000 10.500 N SLC6A14 n/a
7 TRCN0000038301 CCAGTGAACAATATTGGAATA pLKO.1 742 CDS 100% 10.800 7.560 N SLC6A14 n/a
8 TRCN0000079679 GCTGGAATTTACTGGGTTCAT pLKO.1 1509 CDS 100% 4.950 3.465 N Slc6a14 n/a
9 TRCN0000038302 GAAACATCTTTCAACGCCTTA pLKO.1 1873 CDS 100% 4.050 2.835 N SLC6A14 n/a
10 TRCN0000038300 CCTTCTTGATACCTTATGCAA pLKO.1 322 CDS 100% 3.000 2.100 N SLC6A14 n/a
11 TRCN0000137236 GCCTTCTGGATTCAAGTGATT pLKO.1 3733 3UTR 100% 4.950 2.475 Y EOGT n/a
12 TRCN0000079681 CTGGAATTTACTGGGTTCATT pLKO.1 1510 CDS 100% 5.625 3.938 N Slc6a14 n/a
13 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 3703 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007231.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02659 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02659 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479318 GTCATTAGCAAAACTACGGTAACC pLX_317 23.1% 100% 100% V5 n/a
Download CSV