Transcript: Human NM_007334.2

Homo sapiens killer cell lectin like receptor D1 (KLRD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
KLRD1 (3824)
Length:
3165
CDS:
261..707

Additional Resources:

NCBI RefSeq record:
NM_007334.2
NBCI Gene record:
KLRD1 (3824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416718 AGAACTGCATAGCGTATAATC pLKO_005 616 CDS 100% 13.200 18.480 N KLRD1 n/a
2 TRCN0000057409 CCGGTGCAACTGTTACTTCAT pLKO.1 371 CDS 100% 4.950 6.930 N KLRD1 n/a
3 TRCN0000421350 GAAATTCGTTCACCTACATTT pLKO_005 877 3UTR 100% 13.200 9.240 N KLRD1 n/a
4 TRCN0000434614 GACCCAACATTACTAACAATG pLKO_005 741 3UTR 100% 10.800 7.560 N KLRD1 n/a
5 TRCN0000057411 CCAGTATCTATTTCCATCATT pLKO.1 578 CDS 100% 5.625 3.938 N KLRD1 n/a
6 TRCN0000057408 CCCAACATAGAACTCCAGAAA pLKO.1 309 CDS 100% 4.950 3.465 N KLRD1 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1847 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 2898 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
9 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 2898 3UTR 100% 4.950 2.475 Y SPC25 n/a
10 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2891 3UTR 100% 4.950 2.475 Y SPC25 n/a
11 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 2730 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1808 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1808 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1808 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1844 3UTR 100% 4.950 2.475 Y LOC339059 n/a
16 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 2730 3UTR 100% 4.950 2.475 Y OR11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00911 pDONR223 100% 82.3% 81% None 0_1ins69;6_7delAGins26 n/a
2 ccsbBroad304_00911 pLX_304 0% 82.3% 81% V5 0_1ins69;6_7delAGins26 n/a
Download CSV