Transcript: Human NM_007346.4

Homo sapiens opioid growth factor receptor (OGFR), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
OGFR (11054)
Length:
2410
CDS:
26..2059

Additional Resources:

NCBI RefSeq record:
NM_007346.4
NBCI Gene record:
OGFR (11054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007346.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415278 CAGAACTGGACGGACAACTAT pLKO_005 368 CDS 100% 5.625 3.938 N OGFR n/a
2 TRCN0000415480 AGAGTGCCCTGGACTACTTCA pLKO_005 777 CDS 100% 4.950 3.465 N OGFR n/a
3 TRCN0000421573 TGCGAGAACCAGGAGTGAACT pLKO_005 435 CDS 100% 4.950 3.465 N OGFR n/a
4 TRCN0000063645 CATGTGTAGGTATCGGCACAA pLKO.1 238 CDS 100% 4.050 2.835 N OGFR n/a
5 TRCN0000063643 CGGCTGTTTCATTGAGGACAT pLKO.1 343 CDS 100% 4.050 2.835 N OGFR n/a
6 TRCN0000063647 CCGCATCACACGCATCCTCAA pLKO.1 658 CDS 100% 1.350 0.945 N OGFR n/a
7 TRCN0000063646 TGGAGAAGATCGCTCTGAATT pLKO.1 1245 CDS 100% 0.000 0.000 N OGFR n/a
8 TRCN0000063644 CCTTGAGGACAATCACTCCTA pLKO.1 394 CDS 100% 2.640 1.584 N OGFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007346.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11587 pDONR223 100% 96.9% 97% None 1639_1698del;1818G>A n/a
2 ccsbBroad304_11587 pLX_304 0% 96.9% 97% V5 1639_1698del;1818G>A n/a
3 TRCN0000466269 CAATTACCCGTTGGCGTTACTGCA pLX_317 13.8% 96.9% 97% V5 1639_1698del;1818G>A n/a
4 TRCN0000488835 GTACGCTATTTAGTCTCCATTACA pLX_317 19.9% 96.9% 97% V5 (not translated due to prior stop codon) 1639_1698del;1818G>A n/a
5 TRCN0000489561 AATTACCCTGGCTTCCGAGATGTA pLX_317 21.3% 96.9% 96.9% V5 1639_1698del;1818G>A;2031_2032insG n/a
Download CSV