Transcript: Human NM_007351.3

Homo sapiens multimerin 1 (MMRN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
MMRN1 (22915)
Length:
5001
CDS:
119..3805

Additional Resources:

NCBI RefSeq record:
NM_007351.3
NBCI Gene record:
MMRN1 (22915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054295 CGTATCAATGAATATGCCTTA pLKO.1 2264 CDS 100% 4.050 3.240 N MMRN1 n/a
2 TRCN0000423414 ACTCAAGCTGCCCTATCTAAT pLKO_005 3041 CDS 100% 13.200 9.240 N MMRN1 n/a
3 TRCN0000054293 CCCAGAGATGAGAAACTAAAT pLKO.1 2546 CDS 100% 13.200 9.240 N MMRN1 n/a
4 TRCN0000054297 CGGCCCACTTTGACTGATATA pLKO.1 1466 CDS 100% 13.200 9.240 N MMRN1 n/a
5 TRCN0000054296 GCTCTTCAACTGCAAGTATTA pLKO.1 2795 CDS 100% 13.200 9.240 N MMRN1 n/a
6 TRCN0000420765 TAATAGTGAGATCCATCATAA pLKO_005 2389 CDS 100% 13.200 9.240 N MMRN1 n/a
7 TRCN0000422682 TGTCTATAGGATGCAACATAA pLKO_005 883 CDS 100% 13.200 9.240 N MMRN1 n/a
8 TRCN0000413517 TTTACGTTGAGTTGATCAATT pLKO_005 4278 3UTR 100% 13.200 9.240 N MMRN1 n/a
9 TRCN0000054294 CGAAACAACTAGAGGAAAGAA pLKO.1 724 CDS 100% 5.625 3.938 N MMRN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07817 pDONR223 100% 99.9% 99.9% None 2891C>G n/a
2 ccsbBroad304_07817 pLX_304 0% 99.9% 99.9% V5 2891C>G n/a
3 TRCN0000481211 ATCTCATCCTGATGGAGTCTTGTA pLX_317 10.5% 99.9% 99.9% V5 2891C>G n/a
Download CSV