Transcript: Human NM_007373.3

Homo sapiens SHOC2 leucine rich repeat scaffold protein (SHOC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SHOC2 (8036)
Length:
3962
CDS:
350..2098

Additional Resources:

NCBI RefSeq record:
NM_007373.3
NBCI Gene record:
SHOC2 (8036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152103 CGTTTCTCTTGAGGTTCTTAT pLKO.1 1621 CDS 100% 13.200 18.480 N SHOC2 n/a
2 TRCN0000012144 CGGCATAATAAACTGAGAGAA pLKO.1 878 CDS 100% 4.950 6.930 N Shoc2 n/a
3 TRCN0000153425 GCTTAGCATTCGAGAGAACAA pLKO.1 1006 CDS 100% 4.950 6.930 N SHOC2 n/a
4 TRCN0000154171 CAATACGATCAAACGGCCAAA pLKO.1 556 CDS 100% 4.050 5.670 N SHOC2 n/a
5 TRCN0000150918 GCCATCATCAATCAAAGAGTT pLKO.1 694 CDS 100% 4.950 3.960 N SHOC2 n/a
6 TRCN0000151223 GCAGTGCACTTGAAGAATTAA pLKO.1 1266 CDS 100% 15.000 10.500 N SHOC2 n/a
7 TRCN0000150545 GATGCTTGATTTACGGCATAA pLKO.1 865 CDS 100% 10.800 7.560 N SHOC2 n/a
8 TRCN0000154502 GCCTTGGAGAGAACCTACTTA pLKO.1 1848 CDS 100% 5.625 3.938 N SHOC2 n/a
9 TRCN0000153459 CATGCTTAGCATTCGAGAGAA pLKO.1 1003 CDS 100% 4.950 3.465 N SHOC2 n/a
10 TRCN0000151603 GAGAACCTAGAAGAACTGTAT pLKO.1 1898 CDS 100% 4.950 3.465 N SHOC2 n/a
11 TRCN0000153341 GCACATTGCATAGAAGCCATT pLKO.1 3353 3UTR 100% 4.050 2.835 N SHOC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01856 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01856 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466518 AAGGCACCCCCTATCAGGACCTCT pLX_317 22.5% 100% 100% V5 n/a
Download CSV