Transcript: Mouse NM_007421.2

Mus musculus adenylosuccinate synthetase like 1 (Adssl1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adssl1 (11565)
Length:
1806
CDS:
73..1446

Additional Resources:

NCBI RefSeq record:
NM_007421.2
NBCI Gene record:
Adssl1 (11565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423951 GATGTCCTGAGCGAGATTAAA pLKO_005 1174 CDS 100% 15.000 12.000 N Adssl1 n/a
2 TRCN0000076038 CGAAACAGTCTGAAGCTATTT pLKO.1 1540 3UTR 100% 13.200 10.560 N Adssl1 n/a
3 TRCN0000076041 CGATACGCTCACATGGTCAAT pLKO.1 1114 CDS 100% 4.950 3.960 N Adssl1 n/a
4 TRCN0000076039 GCGATGTGTATGGTGTGGTAA pLKO.1 947 CDS 100% 4.950 3.960 N Adssl1 n/a
5 TRCN0000429911 AGAAGGTGGAGGTCGAGTATG pLKO_005 1262 CDS 100% 10.800 7.560 N Adssl1 n/a
6 TRCN0000076040 CGGAAAGAGGATTCCCTACTT pLKO.1 1218 CDS 100% 4.950 3.465 N Adssl1 n/a
7 TRCN0000444548 GACGGCAAGGAGTATGACTTT pLKO_005 298 CDS 100% 4.950 3.465 N Adssl1 n/a
8 TRCN0000432689 GATGTGGAAGGTCAACTCAAA pLKO_005 709 CDS 100% 4.950 3.465 N Adssl1 n/a
9 TRCN0000076042 GTGGAGAATCACATGGGTGTT pLKO.1 1369 CDS 100% 4.050 2.835 N Adssl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04764 pDONR223 100% 89.2% 96.7% None (many diffs) n/a
2 ccsbBroad304_04764 pLX_304 0% 89.2% 96.7% V5 (many diffs) n/a
3 TRCN0000467923 AATTAGAACGCCTTGCGTCCCTCC pLX_317 30.7% 89.2% 96.7% V5 (many diffs) n/a
4 TRCN0000488916 AAGTGTTATCCTCTACTTTAGATG pLX_317 25.3% 89.2% 96.5% V5 (many diffs) n/a
5 TRCN0000488996 TTTATAATACATGACCAGAGGCAT pLX_317 30.6% 88.7% 96.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV