Transcript: Mouse NM_007457.2

Mus musculus adaptor protein complex AP-1, sigma 1 (Ap1s1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ap1s1 (11769)
Length:
1277
CDS:
51..527

Additional Resources:

NCBI RefSeq record:
NM_007457.2
NBCI Gene record:
Ap1s1 (11769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113126 CGTATGTGAGTTGGACATCAT pLKO.1 341 CDS 100% 4.950 6.930 N Ap1s1 n/a
2 TRCN0000113127 TCTCTATTTCTGCTGCGCCAT pLKO.1 242 CDS 100% 2.160 1.728 N Ap1s1 n/a
3 TRCN0000065210 AGGGACCTCAAAGTTGTCTAT pLKO.1 207 CDS 100% 4.950 3.465 N AP1S1 n/a
4 TRCN0000300227 AGGGACCTCAAAGTTGTCTAT pLKO_005 207 CDS 100% 4.950 3.465 N AP1S1 n/a
5 TRCN0000113128 GAGGGACCTCAAAGTTGTCTA pLKO.1 206 CDS 100% 4.950 3.465 N Ap1s1 n/a
6 TRCN0000113129 CTACTTTATCCTGGACGAGTT pLKO.1 380 CDS 100% 4.050 2.835 N Ap1s1 n/a
7 TRCN0000113125 CCACCTTACCTACTTTAGAAA pLKO.1 653 3UTR 100% 5.625 7.875 N Ap1s1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13832 pDONR223 100% 74.1% 79.7% None (many diffs) n/a
2 ccsbBroad304_13832 pLX_304 0% 74.1% 79.7% V5 (many diffs) n/a
3 TRCN0000471744 ACAAGTCACTCGCGCGCAGACCCG pLX_317 100% 74.1% 79.7% V5 (many diffs) n/a
Download CSV