Transcript: Mouse NM_007475.5

Mus musculus ribosomal protein, large, P0 (Rplp0), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rplp0 (11837)
Length:
1360
CDS:
122..1075

Additional Resources:

NCBI RefSeq record:
NM_007475.5
NBCI Gene record:
Rplp0 (11837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007475.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104535 CCTGCTTAATTTGAGAAAGAT pLKO.1 1099 3UTR 100% 5.625 3.938 N Rplp0 n/a
2 TRCN0000316607 CCTGCTTAATTTGAGAAAGAT pLKO_005 1099 3UTR 100% 5.625 3.938 N Rplp0 n/a
3 TRCN0000104536 CGGAGGAATCAGATGAGGATA pLKO.1 1032 CDS 100% 4.950 3.465 N Rplp0 n/a
4 TRCN0000316610 CGGAGGAATCAGATGAGGATA pLKO_005 1032 CDS 100% 4.950 3.465 N Rplp0 n/a
5 TRCN0000104537 GCTGATAAAGACTGGAGACAA pLKO.1 598 CDS 100% 4.950 3.465 N Rplp0 n/a
6 TRCN0000316538 GCTGATAAAGACTGGAGACAA pLKO_005 598 CDS 100% 4.950 3.465 N Rplp0 n/a
7 TRCN0000104538 CCTCACTGAGATTCGGGATAT pLKO.1 403 CDS 100% 10.800 6.480 N Rplp0 n/a
8 TRCN0000349099 CCTCACTGAGATTCGGGATAT pLKO_005 403 CDS 100% 10.800 6.480 N Rplp0 n/a
9 TRCN0000104539 GCCAAAGCTGAAGCAAAGGAA pLKO.1 1007 CDS 100% 3.000 1.800 N Rplp0 n/a
10 TRCN0000349175 GCCAAAGCTGAAGCAAAGGAA pLKO_005 1007 CDS 100% 3.000 1.800 N Rplp0 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007475.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06887 pDONR223 100% 90.4% 97.4% None (many diffs) n/a
2 ccsbBroad304_06887 pLX_304 0% 90.4% 97.4% V5 (many diffs) n/a
3 TRCN0000469213 GTCCTAATACCTTTCCTTACCAGA pLX_317 51.3% 90.4% 97.4% V5 (many diffs) n/a
4 ccsbBroadEn_01441 pDONR223 100% 90.4% 97.4% None (many diffs) n/a
5 ccsbBroad304_01441 pLX_304 0% 90.4% 97.4% V5 (many diffs) n/a
6 TRCN0000473471 GGCAACGGAACGTTATTAGGTACT pLX_317 41.1% 90.4% 97.4% V5 (many diffs) n/a
7 ccsbBroadEn_15575 pDONR223 0% 90.3% 97.1% None (many diffs) n/a
8 ccsbBroad304_15575 pLX_304 0% 90.3% 97.1% V5 (many diffs) n/a
9 TRCN0000471568 CGTGCTACGAGCTATTCGTACCGT pLX_317 41.1% 90.3% 97.1% V5 (many diffs) n/a
10 ccsbBroadEn_10284 pDONR223 100% 86.4% 84.9% None (many diffs) n/a
11 ccsbBroad304_10284 pLX_304 0% 86.4% 84.9% V5 (many diffs) n/a
12 TRCN0000479640 ACTGACATAGCGGCAACACCATGC pLX_317 41.3% 86.4% 84.9% V5 (many diffs) n/a
Download CSV