Transcript: Mouse NM_007478.3

Mus musculus ADP-ribosylation factor 3 (Arf3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Arf3 (11842)
Length:
3481
CDS:
229..774

Additional Resources:

NCBI RefSeq record:
NM_007478.3
NBCI Gene record:
Arf3 (11842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100394 CGTCACCGCAATTGGTACATT pLKO.1 673 CDS 100% 5.625 7.875 N Arf3 n/a
2 TRCN0000324907 CGTCACCGCAATTGGTACATT pLKO_005 673 CDS 100% 5.625 7.875 N Arf3 n/a
3 TRCN0000100392 CAAGGCTTGATATTTGTGGTT pLKO.1 484 CDS 100% 2.640 3.696 N Arf3 n/a
4 TRCN0000380674 ATCCCGACCATTGGGTTTAAT pLKO_005 364 CDS 100% 15.000 12.000 N Arf3 n/a
5 TRCN0000382466 ATTTGCCGAATGCTATGAATG pLKO_005 614 CDS 100% 10.800 7.560 N Arf3 n/a
6 TRCN0000100391 GCTCCTTGTGTTTGCAAACAA pLKO.1 588 CDS 100% 5.625 3.938 N Arf3 n/a
7 TRCN0000324908 GCTCCTTGTGTTTGCAAACAA pLKO_005 588 CDS 100% 5.625 3.938 N Arf3 n/a
8 TRCN0000100393 GAAGAGCCTAATCGGCAAGAA pLKO.1 255 CDS 100% 4.950 3.465 N Arf3 n/a
9 TRCN0000324905 GAAGAGCCTAATCGGCAAGAA pLKO_005 255 CDS 100% 4.950 3.465 N Arf3 n/a
10 TRCN0000100390 CCTCAGTATCAACTCCCTGTT pLKO.1 1863 3UTR 100% 4.050 2.835 N Arf3 n/a
11 TRCN0000324823 CCTCAGTATCAACTCCCTGTT pLKO_005 1863 3UTR 100% 4.050 2.835 N Arf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00095 pDONR223 100% 92.8% 100% None (many diffs) n/a
2 ccsbBroad304_00095 pLX_304 0% 92.8% 100% V5 (many diffs) n/a
3 TRCN0000467892 AAGACCTTCCAAGGGGGGATCTAG pLX_317 85.4% 92.8% 100% V5 (many diffs) n/a
4 ccsbBroadEn_00094 pDONR223 100% 84.1% 96.1% None (many diffs) n/a
5 ccsbBroad304_00094 pLX_304 0% 84.1% 96.1% V5 (many diffs) n/a
6 TRCN0000470051 AGACATCCAACAGCAAGTTGGGTG pLX_317 77.4% 84.1% 96.1% V5 (many diffs) n/a
Download CSV