Transcript: Mouse NM_007513.4

Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc7a1 (11987)
Length:
7195
CDS:
281..2149

Additional Resources:

NCBI RefSeq record:
NM_007513.4
NBCI Gene record:
Slc7a1 (11987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007513.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079365 CCCGGACATATTTGCTGTGAT pLKO.1 769 CDS 100% 4.950 6.930 N Slc7a1 n/a
2 TRCN0000042965 CCTACATCATCGGTACTTCAA pLKO.1 639 CDS 100% 4.950 6.930 N SLC7A1 n/a
3 TRCN0000290045 CCTACATCATCGGTACTTCAA pLKO_005 639 CDS 100% 4.950 6.930 N SLC7A1 n/a
4 TRCN0000079367 GCTGATAGGTTTCACCATCTA pLKO.1 2038 CDS 100% 4.950 6.930 N Slc7a1 n/a
5 TRCN0000079364 CCGGACATATTTGCTGTGATT pLKO.1 770 CDS 100% 4.950 3.960 N Slc7a1 n/a
6 TRCN0000079363 CCTCACAATCTCTCCACTCAT pLKO.1 2209 3UTR 100% 4.950 3.465 N Slc7a1 n/a
7 TRCN0000079366 CCTCCAAATTCTCAGGGCTAA pLKO.1 1722 CDS 100% 4.050 2.835 N Slc7a1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4688 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007513.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01546 pDONR223 100% 83.8% 86.6% None (many diffs) n/a
2 ccsbBroad304_01546 pLX_304 0% 83.8% 86.6% V5 (many diffs) n/a
3 TRCN0000469257 AAGTTTCTCATTACTCGCTGTCGC pLX_317 20.6% 83.8% 86.6% V5 (many diffs) n/a
Download CSV