Transcript: Mouse NM_007555.4

Mus musculus bone morphogenetic protein 5 (Bmp5), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Bmp5 (12160)
Length:
3827
CDS:
729..2093

Additional Resources:

NCBI RefSeq record:
NM_007555.4
NBCI Gene record:
Bmp5 (12160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007555.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065611 CGCAATAAATCCAACTCTCAT pLKO.1 1704 CDS 100% 4.950 6.930 N Bmp5 n/a
2 TRCN0000065610 CGGTTTGATCTGACCCAGATT pLKO.1 1269 CDS 100% 4.950 3.960 N Bmp5 n/a
3 TRCN0000065612 CGGGAAATACAGAGGGAAATT pLKO.1 873 CDS 100% 13.200 9.240 N Bmp5 n/a
4 TRCN0000065608 GCTATGTTTATGACCACAATA pLKO.1 2130 3UTR 100% 13.200 9.240 N Bmp5 n/a
5 TRCN0000065609 CCACAGAACAATTTGGGCTTA pLKO.1 1515 CDS 100% 4.050 2.430 N Bmp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007555.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00166 pDONR223 100% 89.4% 93.1% None (many diffs) n/a
2 ccsbBroad304_00166 pLX_304 0% 89.4% 93.1% V5 (many diffs) n/a
3 TRCN0000472902 ATCCAAGTAAGTCGTATTTTTTTA pLX_317 33.5% 89.4% 93.1% V5 (many diffs) n/a
Download CSV