Transcript: Mouse NM_007636.2

Mus musculus chaperonin containing Tcp1, subunit 2 (beta) (Cct2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cct2 (12461)
Length:
1962
CDS:
107..1714

Additional Resources:

NCBI RefSeq record:
NM_007636.2
NBCI Gene record:
Cct2 (12461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120469 GCTCACAGTGAAGGCCATATA pLKO.1 1508 CDS 100% 13.200 9.240 N Cct2 n/a
2 TRCN0000345559 GCTCACAGTGAAGGCCATATA pLKO_005 1508 CDS 100% 13.200 9.240 N Cct2 n/a
3 TRCN0000120470 GCTACCATTCTCAAGAACATT pLKO.1 308 CDS 100% 5.625 3.938 N Cct2 n/a
4 TRCN0000345556 GCTACCATTCTCAAGAACATT pLKO_005 308 CDS 100% 5.625 3.938 N Cct2 n/a
5 TRCN0000120471 GCTCTCGGGTAAGAGTTGATT pLKO.1 864 CDS 100% 5.625 3.938 N Cct2 n/a
6 TRCN0000345557 GCTCTCGGGTAAGAGTTGATT pLKO_005 864 CDS 100% 5.625 3.938 N Cct2 n/a
7 TRCN0000120467 GCATTCCCATTTGCTGATGAA pLKO.1 1715 CDS 100% 4.950 3.465 N Cct2 n/a
8 TRCN0000120468 GCTGTAGCAATGGAGTCGTTT pLKO.1 1403 CDS 100% 4.950 3.465 N Cct2 n/a
9 TRCN0000345558 GCTGTAGCAATGGAGTCGTTT pLKO_005 1403 CDS 100% 4.950 3.465 N Cct2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07642 pDONR223 100% 89% 97.5% None (many diffs) n/a
2 ccsbBroad304_07642 pLX_304 0% 89% 97.5% V5 (many diffs) n/a
3 ccsbBroadEn_15719 pDONR223 0% 89% 97.5% None (many diffs) n/a
4 ccsbBroad304_15719 pLX_304 0% 89% 97.5% V5 (many diffs) n/a
Download CSV