Transcript: Mouse NM_007638.4

Mus musculus chaperonin containing Tcp1, subunit 7 (eta) (Cct7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cct7 (12468)
Length:
2452
CDS:
618..2252

Additional Resources:

NCBI RefSeq record:
NM_007638.4
NBCI Gene record:
Cct7 (12468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120459 CGTGGATGAGACTATCAAGAA pLKO.1 2162 CDS 100% 4.950 6.930 N Cct7 n/a
2 TRCN0000345215 CGTGGATGAGACTATCAAGAA pLKO_005 2162 CDS 100% 4.950 6.930 N Cct7 n/a
3 TRCN0000120458 CGTGGCATGGACAAACTTATT pLKO.1 744 CDS 100% 13.200 9.240 N Cct7 n/a
4 TRCN0000120460 GCCAAAGTCATCTTGTCTAAA pLKO.1 1473 CDS 100% 13.200 9.240 N Cct7 n/a
5 TRCN0000345214 GCCAAAGTCATCTTGTCTAAA pLKO_005 1473 CDS 100% 13.200 9.240 N Cct7 n/a
6 TRCN0000120461 GCCGACAACTTCCAGGCATTT pLKO.1 2070 CDS 100% 10.800 7.560 N Cct7 n/a
7 TRCN0000120457 GATGAGAAGATGGTTGCTGGT pLKO.1 2294 3UTR 100% 2.160 1.512 N Cct7 n/a
8 TRCN0000353181 GATGAGAAGATGGTTGCTGGT pLKO_005 2294 3UTR 100% 2.160 1.512 N Cct7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007638.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07641 pDONR223 100% 89.1% 95.9% None (many diffs) n/a
2 ccsbBroad304_07641 pLX_304 0% 89.1% 95.9% V5 (many diffs) n/a
3 TRCN0000466543 TTCTGTAACGCGAACGGGTCCGGC pLX_317 23.1% 89.1% 95.9% V5 (many diffs) n/a
Download CSV