Transcript: Mouse NM_007644.4

Mus musculus scavenger receptor class B, member 2 (Scarb2), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Scarb2 (12492)
Length:
4729
CDS:
350..1786

Additional Resources:

NCBI RefSeq record:
NM_007644.4
NBCI Gene record:
Scarb2 (12492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007644.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313026 ATCGAGAAGAATATGGTATTA pLKO_005 458 CDS 100% 13.200 18.480 N Scarb2 n/a
2 TRCN0000066631 GCAGGTCAGTACATATCACTT pLKO.1 1170 CDS 100% 4.950 6.930 N Scarb2 n/a
3 TRCN0000066630 CGTTGACTTGATTAGAACAAT pLKO.1 736 CDS 100% 5.625 4.500 N Scarb2 n/a
4 TRCN0000312027 CGTTGACTTGATTAGAACAAT pLKO_005 736 CDS 100% 5.625 4.500 N Scarb2 n/a
5 TRCN0000066629 CGGCCTGTTCTATGAGAGAAA pLKO.1 946 CDS 100% 4.950 3.960 N Scarb2 n/a
6 TRCN0000312980 ATCTTGTCCCTCGTCCATATT pLKO_005 899 CDS 100% 13.200 9.240 N Scarb2 n/a
7 TRCN0000066632 GCTGTCACCAATAAGGCATAT pLKO.1 680 CDS 100% 10.800 7.560 N Scarb2 n/a
8 TRCN0000312026 GCTGTCACCAATAAGGCATAT pLKO_005 680 CDS 100% 10.800 7.560 N Scarb2 n/a
9 TRCN0000066628 GCCTGTCAAGAAGGAAACATA pLKO.1 1883 3UTR 100% 5.625 3.938 N Scarb2 n/a
10 TRCN0000312028 GCCTGTCAAGAAGGAAACATA pLKO_005 1883 3UTR 100% 5.625 3.938 N Scarb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007644.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00257 pDONR223 100% 84.5% 85.7% None (many diffs) n/a
2 ccsbBroad304_00257 pLX_304 0% 84.5% 85.7% V5 (many diffs) n/a
3 TRCN0000479790 TTTATTTCGGACAGGATTGCCTGA pLX_317 23.1% 84.5% 85.7% V5 (many diffs) n/a
Download CSV