Transcript: Mouse NM_007670.4

Mus musculus cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) (Cdkn2b), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Cdkn2b (12579)
Length:
1393
CDS:
236..628

Additional Resources:

NCBI RefSeq record:
NM_007670.4
NBCI Gene record:
Cdkn2b (12579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007670.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362419 CCTTTCAGGACGCGGTGTAAA pLKO_005 883 3UTR 100% 13.200 18.480 N Cdkn2b n/a
2 TRCN0000362499 ACCGTGACATTGCGAGGTATC pLKO_005 585 CDS 100% 6.000 8.400 N Cdkn2b n/a
3 TRCN0000362420 GCCCAATCCAGGTCATGATGA pLKO_005 357 CDS 100% 4.950 3.960 N Cdkn2b n/a
4 TRCN0000042600 GCGCCCAATCCAGGTCATGAT pLKO.1 355 CDS 100% 1.650 1.320 N Cdkn2b n/a
5 TRCN0000042602 CGCAGATCCCAACGCCCTGAA pLKO.1 322 CDS 100% 0.000 0.000 N Cdkn2b n/a
6 TRCN0000042598 CGACAAGGAAATAGTGAAATT pLKO.1 1155 3UTR 100% 13.200 9.240 N Cdkn2b n/a
7 TRCN0000042599 CCACCGTGACATTGCGAGGTA pLKO.1 583 CDS 100% 0.880 0.616 N Cdkn2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007670.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10727 pDONR223 100% 48% 52% None (many diffs) n/a
2 ccsbBroad304_10727 pLX_304 0% 48% 52% V5 (many diffs) n/a
3 TRCN0000472814 GGACATTGCTGCCATTCTGAACGC pLX_317 87.1% 48% 52% V5 (many diffs) n/a
Download CSV