Transcript: Mouse NM_007684.3

Mus musculus centrin 3 (Cetn3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cetn3 (12626)
Length:
1013
CDS:
50..553

Additional Resources:

NCBI RefSeq record:
NM_007684.3
NBCI Gene record:
Cetn3 (12626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090580 CGATGACGATTCAGGAAAGAT pLKO.1 382 CDS 100% 5.625 7.875 N Cetn3 n/a
2 TRCN0000309468 CGATGACGATTCAGGAAAGAT pLKO_005 382 CDS 100% 5.625 7.875 N Cetn3 n/a
3 TRCN0000090581 GCTGTTTGATACCGACAAAGA pLKO.1 154 CDS 100% 4.950 6.930 N Cetn3 n/a
4 TRCN0000309544 GCTGTTTGATACCGACAAAGA pLKO_005 154 CDS 100% 4.950 6.930 N Cetn3 n/a
5 TRCN0000090578 CCAAGCATCCTTTGTATGTAT pLKO.1 667 3UTR 100% 5.625 3.938 N Cetn3 n/a
6 TRCN0000309541 CCAAGCATCCTTTGTATGTAT pLKO_005 667 3UTR 100% 5.625 3.938 N Cetn3 n/a
7 TRCN0000090579 GCTGATGTGTTGAAGATTCTT pLKO.1 239 CDS 100% 5.625 3.938 N Cetn3 n/a
8 TRCN0000309470 GCTGATGTGTTGAAGATTCTT pLKO_005 239 CDS 100% 5.625 3.938 N Cetn3 n/a
9 TRCN0000090582 GAGAGATAAATCAAGAGGAAT pLKO.1 504 CDS 100% 4.950 3.465 N Cetn3 n/a
10 TRCN0000309545 GAGAGATAAATCAAGAGGAAT pLKO_005 504 CDS 100% 4.950 3.465 N Cetn3 n/a
11 TRCN0000055840 GCTATTATGACTGGTGACATT pLKO.1 530 CDS 100% 4.950 3.465 N CETN3 n/a
12 TRCN0000299758 GCTATTATGACTGGTGACATT pLKO_005 530 CDS 100% 4.950 3.465 N CETN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00294 pDONR223 100% 89% 98.8% None (many diffs) n/a
2 ccsbBroad304_00294 pLX_304 0% 89% 98.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471571 GCCGCTCGCTTACGCTACTTCGTA pLX_317 82.7% 89% 98.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV