Transcript: Mouse NM_007707.3

Mus musculus suppressor of cytokine signaling 3 (Socs3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Socs3 (12702)
Length:
2742
CDS:
581..1258

Additional Resources:

NCBI RefSeq record:
NM_007707.3
NBCI Gene record:
Socs3 (12702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231180 GGCTAGGAGACTCGCCTTAAA pLKO_005 2074 3UTR 100% 13.200 18.480 N Socs3 n/a
2 TRCN0000231176 TCTTCACGTTGAGCGTCAAGA pLKO_005 816 CDS 100% 4.950 6.930 N Socs3 n/a
3 TRCN0000067471 CTTCTTCACGTTGAGCGTCAA pLKO.1 814 CDS 100% 4.050 5.670 N Socs3 n/a
4 TRCN0000231178 GAGAGCTTACTACATCTATTC pLKO_005 1066 CDS 100% 10.800 8.640 N Socs3 n/a
5 TRCN0000067470 CAAGAGAGCTTACTACATCTA pLKO.1 1063 CDS 100% 4.950 3.960 N Socs3 n/a
6 TRCN0000067472 GCTGCAGGAGAGCGGATTCTA pLKO.1 700 CDS 100% 1.875 1.500 N Socs3 n/a
7 TRCN0000067468 GCTAGGAGACTCGCCTTAAAT pLKO.1 2075 3UTR 100% 15.000 10.500 N Socs3 n/a
8 TRCN0000231179 CAGTATGATGCTCCACTTTAA pLKO_005 1238 CDS 100% 13.200 9.240 N Socs3 n/a
9 TRCN0000057073 CCACCTGGACTCCTATGAGAA pLKO.1 1177 CDS 100% 4.950 3.465 N SOCS3 n/a
10 TRCN0000231177 CGCTTCGACTGTGTACTCAAG pLKO_005 926 CDS 100% 4.050 2.835 N Socs3 n/a
11 TRCN0000067469 GATCAGTATGATGCTCCACTT pLKO.1 1235 CDS 100% 4.050 2.835 N Socs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02064 pDONR223 100% 90.8% 96.8% None (many diffs) n/a
2 ccsbBroad304_02064 pLX_304 73.9% 90.8% 96.8% V5 (many diffs) n/a
3 TRCN0000474462 GATCCTGCTCCCCCCCCCGGTTTT pLX_317 17.4% 90.8% 96.8% V5 (many diffs) n/a
Download CSV