Transcript: Mouse NM_007721.4

Mus musculus chemokine (C-C motif) receptor 10 (Ccr10), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ccr10 (12777)
Length:
1725
CDS:
21..1109

Additional Resources:

NCBI RefSeq record:
NM_007721.4
NBCI Gene record:
Ccr10 (12777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007721.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028159 GCAACCCAACTACTGTTACTA pLKO.1 1260 3UTR 100% 5.625 7.875 N Ccr10 n/a
2 TRCN0000028145 CAAGCGCAAGGATCTAGCTTT pLKO.1 875 CDS 100% 4.950 3.465 N Ccr10 n/a
3 TRCN0000028152 GCTCTGTTACAAGGCTGATGT pLKO.1 107 CDS 100% 4.950 3.465 N Ccr10 n/a
4 TRCN0000028143 GCTGGAATCTAGGAAGTACCA pLKO.1 334 CDS 100% 2.640 1.848 N Ccr10 n/a
5 TRCN0000028135 GCAGCCTCAATCCGGTGCTTT pLKO.1 928 CDS 100% 1.650 1.155 N Ccr10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007721.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488243 AGGAGCCCTGGTGGGTTTCCGCCG pLX_317 30% 85.2% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488260 CTTGCCTTCCACCGGTTGCGGGCA pLX_317 30% 85.1% 87.8% V5 (many diffs) n/a
Download CSV