Transcript: Mouse NM_007761.2

Mus musculus calcitonin gene-related peptide-receptor component protein (Crcp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Crcp (12909)
Length:
1474
CDS:
95..541

Additional Resources:

NCBI RefSeq record:
NM_007761.2
NBCI Gene record:
Crcp (12909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126290 CCAGTTACTAACGGATCTCAA pLKO.1 145 CDS 100% 4.950 6.930 N Crcp n/a
2 TRCN0000316093 CCAGTTACTAACGGATCTCAA pLKO_005 145 CDS 100% 4.950 6.930 N Crcp n/a
3 TRCN0000126291 CCAGAGGATGAACAGAGCAAA pLKO.1 476 CDS 100% 4.950 3.465 N Crcp n/a
4 TRCN0000316163 CCAGAGGATGAACAGAGCAAA pLKO_005 476 CDS 100% 4.950 3.465 N Crcp n/a
5 TRCN0000126293 CACTAGCAATGACGTGGCTAT pLKO.1 499 CDS 100% 4.050 2.835 N Crcp n/a
6 TRCN0000349150 CACTAGCAATGACGTGGCTAT pLKO_005 499 CDS 100% 4.050 2.835 N Crcp n/a
7 TRCN0000126289 GCCCACATTGACCTTGAACTT pLKO.1 1260 3UTR 100% 4.950 2.970 N Crcp n/a
8 TRCN0000349077 GCCCACATTGACCTTGAACTT pLKO_005 1260 3UTR 100% 4.950 2.970 N Crcp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488724 AAGTTCTTCTTGTCAAACGAACTG pLX_317 82% 83.6% 88.5% V5 (many diffs) n/a
2 ccsbBroadEn_03023 pDONR223 100% 65.1% 67.5% None (many diffs) n/a
3 ccsbBroad304_03023 pLX_304 0% 65.1% 67.5% V5 (many diffs) n/a
4 TRCN0000466312 GGGAGGACGGGTCATTGCGTAGCG pLX_317 60% 65.1% 67.5% V5 (many diffs) n/a
Download CSV