Transcript: Mouse NM_007838.2

Mus musculus dolichyl-di-phosphooligosaccharide-protein glycotransferase (Ddost), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ddost (13200)
Length:
2134
CDS:
142..1467

Additional Resources:

NCBI RefSeq record:
NM_007838.2
NBCI Gene record:
Ddost (13200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093833 GAGTATAGCATCATCATAGAA pLKO.1 1090 CDS 100% 5.625 7.875 N Ddost n/a
2 TRCN0000351682 GAGTATAGCATCATCATAGAA pLKO_005 1090 CDS 100% 5.625 7.875 N Ddost n/a
3 TRCN0000311334 AGTGAGTGTGGGATTGAATTT pLKO_005 523 CDS 100% 13.200 10.560 N Ddost n/a
4 TRCN0000093829 GCAGCTCACAACCTTCTATAA pLKO.1 1951 3UTR 100% 13.200 9.240 N Ddost n/a
5 TRCN0000093830 GCCTGACGTGTATGGTGTATT pLKO.1 1239 CDS 100% 13.200 9.240 N Ddost n/a
6 TRCN0000351608 GCCTGACGTGTATGGTGTATT pLKO_005 1239 CDS 100% 13.200 9.240 N Ddost n/a
7 TRCN0000035385 GTATGGTGTATTCCAGTTTAA pLKO.1 1248 CDS 100% 13.200 9.240 N DDOST n/a
8 TRCN0000093832 GTGGAGTATAGCATCATCATA pLKO.1 1087 CDS 100% 5.625 3.938 N Ddost n/a
9 TRCN0000093831 CCCATTCTCTTCCGAGGAGTT pLKO.1 676 CDS 100% 4.050 2.835 N Ddost n/a
10 TRCN0000351640 CCCATTCTCTTCCGAGGAGTT pLKO_005 676 CDS 100% 4.050 2.835 N Ddost n/a
11 TRCN0000305450 TGAATCACTCTGTGGCAATTT pLKO_005 1639 3UTR 100% 13.200 7.920 N Ddost n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06090 pDONR223 100% 85.2% 91.8% None (many diffs) n/a
2 ccsbBroad304_06090 pLX_304 0% 85.2% 91.8% V5 (many diffs) n/a
3 TRCN0000471340 ACCAACACTTTAAGAAACATTCGC pLX_317 33.5% 85.2% 91.8% V5 (many diffs) n/a
Download CSV