Transcript: Mouse NM_007869.3

Mus musculus DnaJ heat shock protein family (Hsp40) member C1 (Dnajc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dnajc1 (13418)
Length:
5497
CDS:
331..1989

Additional Resources:

NCBI RefSeq record:
NM_007869.3
NBCI Gene record:
Dnajc1 (13418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022308 GCATATCGTAAGCTTTCACTA pLKO.1 568 CDS 100% 4.950 6.930 N DNAJC1 n/a
2 TRCN0000280286 GCATATCGTAAGCTTTCACTA pLKO_005 568 CDS 100% 4.950 6.930 N DNAJC1 n/a
3 TRCN0000008542 GCAGTTGAACTTCTACGAGTT pLKO.1 504 CDS 100% 4.050 5.670 N Dnajc1 n/a
4 TRCN0000274523 GCAGTTGAACTTCTACGAGTT pLKO_005 504 CDS 100% 4.050 5.670 N Dnajc1 n/a
5 TRCN0000274471 GAACGAAAGATTGCTTATAAA pLKO_005 945 CDS 100% 15.000 10.500 N Dnajc1 n/a
6 TRCN0000273751 ACTGACAAGAAGTATGGTTAA pLKO_005 1335 CDS 100% 10.800 7.560 N Dnajc1 n/a
7 TRCN0000008543 CCTGTGTATATGCCTTTAGAA pLKO.1 1180 CDS 100% 5.625 3.938 N Dnajc1 n/a
8 TRCN0000274469 CCTGTGTATATGCCTTTAGAA pLKO_005 1180 CDS 100% 5.625 3.938 N Dnajc1 n/a
9 TRCN0000008540 CCAGACAAGAATAAAGATGAA pLKO.1 598 CDS 100% 4.950 3.465 N Dnajc1 n/a
10 TRCN0000008541 GCTAGATACAAGCTGCTGGTT pLKO.1 1933 CDS 100% 2.640 1.848 N Dnajc1 n/a
11 TRCN0000274470 GCTAGATACAAGCTGCTGGTT pLKO_005 1933 CDS 100% 2.640 1.848 N Dnajc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12460 pDONR223 100% 52.9% 51.9% None (many diffs) n/a
2 ccsbBroad304_12460 pLX_304 0% 52.9% 51.9% V5 (many diffs) n/a
3 TRCN0000465875 TCTCCACTCTCTTGAGCCTGCTCG pLX_317 14.7% 52.9% 51.9% V5 (many diffs) n/a
Download CSV