Transcript: Mouse NM_007918.3

Mus musculus eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Eif4ebp1 (13685)
Length:
981
CDS:
83..436

Additional Resources:

NCBI RefSeq record:
NM_007918.3
NBCI Gene record:
Eif4ebp1 (13685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075609 CAGGATTATCTATGACCGGAA pLKO.1 229 CDS 100% 2.160 3.024 N Eif4ebp1 n/a
2 TRCN0000348615 ATTATCTATGACCGGAAATTT pLKO_005 233 CDS 100% 15.000 10.500 N Eif4ebp1 n/a
3 TRCN0000075612 AGGCGGTGAAGAGTCACAATT pLKO.1 400 CDS 100% 13.200 9.240 N Eif4ebp1 n/a
4 TRCN0000335449 AGGCGGTGAAGAGTCACAATT pLKO_005 400 CDS 100% 13.200 9.240 N Eif4ebp1 n/a
5 TRCN0000075608 CCAGTGTTTATGGTGTGATTT pLKO.1 912 3UTR 100% 13.200 9.240 N Eif4ebp1 n/a
6 TRCN0000075610 GTCACAATTTGAGATGGACAT pLKO.1 412 CDS 100% 4.050 2.835 N Eif4ebp1 n/a
7 TRCN0000335450 GTCACAATTTGAGATGGACAT pLKO_005 412 CDS 100% 4.050 2.835 N Eif4ebp1 n/a
8 TRCN0000075611 CCAAAGGACCTGCCAGCCATT pLKO.1 293 CDS 100% 1.350 0.675 Y Eif4ebp1 n/a
9 TRCN0000335381 CCAAAGGACCTGCCAGCCATT pLKO_005 293 CDS 100% 1.350 0.675 Y Eif4ebp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00490 pDONR223 100% 89.8% 90.6% None (many diffs) n/a
2 ccsbBroad304_00490 pLX_304 97.5% 89.8% 90.6% V5 (many diffs) n/a
3 TRCN0000468751 TGAACACGATACCGGTTTCGATCC pLX_317 100% 89.8% 90.6% V5 (many diffs) n/a
Download CSV