Transcript: Mouse NM_007926.2

Mus musculus aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (Aimp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Aimp1 (13722)
Length:
1122
CDS:
86..1045

Additional Resources:

NCBI RefSeq record:
NM_007926.2
NBCI Gene record:
Aimp1 (13722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103790 GCGGATCAGATCATCGAATAT pLKO.1 164 CDS 100% 13.200 18.480 N Aimp1 n/a
2 TRCN0000331859 GCGGATCAGATCATCGAATAT pLKO_005 164 CDS 100% 13.200 18.480 N Aimp1 n/a
3 TRCN0000103793 AGAGCCTGACAAGGAGCTAAA pLKO.1 880 CDS 100% 10.800 7.560 N Aimp1 n/a
4 TRCN0000302777 AGAGCCTGACAAGGAGCTAAA pLKO_005 880 CDS 100% 10.800 7.560 N Aimp1 n/a
5 TRCN0000103792 CAGGCAACAATGAGAGAAGAA pLKO.1 227 CDS 100% 4.950 3.465 N Aimp1 n/a
6 TRCN0000302776 CAGGCAACAATGAGAGAAGAA pLKO_005 227 CDS 100% 4.950 3.465 N Aimp1 n/a
7 TRCN0000103794 GAGCTAAAGCAAGAGCTGATT pLKO.1 293 CDS 100% 4.950 3.465 N Aimp1 n/a
8 TRCN0000302705 GAGCTAAAGCAAGAGCTGATT pLKO_005 293 CDS 100% 4.950 3.465 N Aimp1 n/a
9 TRCN0000103791 CTGGTGAATCATGTTCCTCTA pLKO.1 683 CDS 100% 4.050 2.430 N Aimp1 n/a
10 TRCN0000302703 CTGGTGAATCATGTTCCTCTA pLKO_005 683 CDS 100% 4.050 2.430 N Aimp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02124 pDONR223 100% 81.4% 83.5% None (many diffs) n/a
2 ccsbBroad304_02124 pLX_304 0% 81.4% 83.5% V5 (many diffs) n/a
3 TRCN0000465534 GACTCACCTACAGCCCCGATCGCG pLX_317 33.6% 81.4% 83.5% V5 (many diffs) n/a
Download CSV