Transcript: Mouse NM_007965.3

Mus musculus Ena-vasodilator stimulated phosphoprotein (Evl), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Evl (14026)
Length:
2139
CDS:
490..1671

Additional Resources:

NCBI RefSeq record:
NM_007965.3
NBCI Gene record:
Evl (14026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007965.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091074 CCGTCAGGTCTATGGCTTAAA pLKO.1 741 CDS 100% 13.200 18.480 N Evl n/a
2 TRCN0000063870 CCGGATCAACATCTACCACAA pLKO.1 591 CDS 100% 4.050 5.670 N EVL n/a
3 TRCN0000091076 GCCCGTCAGGTCTATGGCTTA pLKO.1 739 CDS 100% 1.350 1.890 N Evl n/a
4 TRCN0000091075 CCTCATGGAAGAAATGAACAA pLKO.1 1281 CDS 100% 4.950 3.465 N Evl n/a
5 TRCN0000091073 GCTTTATTAGATGGCTTCCAA pLKO.1 1919 3UTR 100% 3.000 2.100 N Evl n/a
6 TRCN0000091077 GACACCAGTAAGAAGTGGGTA pLKO.1 541 CDS 100% 2.640 1.848 N Evl n/a
7 TRCN0000294336 ACGATGACACCAGTAAGAAAT pLKO_005 536 CDS 100% 13.200 9.240 N EVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007965.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10459 pDONR223 100% 84.4% 88.9% None (many diffs) n/a
2 ccsbBroad304_10459 pLX_304 0% 84.4% 88.9% V5 (many diffs) n/a
3 TRCN0000471524 TTTACTACCAGAGTAGATCTTTTT pLX_317 17.9% 84.4% 88.9% V5 (many diffs) n/a
4 ccsbBroadEn_03311 pDONR223 100% 83.9% 88.2% None (many diffs) n/a
5 ccsbBroad304_03311 pLX_304 0% 83.9% 88.2% V5 (many diffs) n/a
Download CSV