Construct: ORF TRCN0000471524
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017589.1_s317c1
- Derived from:
- ccsbBroadEn_10459
- DNA Barcode:
- TTTACTACCAGAGTAGATCTTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EVL (51466)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471524
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51466 | EVL | Enah/Vasp-like | NM_001330221.2 | 100% | 100% | |
2 | human | 51466 | EVL | Enah/Vasp-like | NM_016337.3 | 99.5% | 99.2% | 4_9delGCCACA |
3 | human | 51466 | EVL | Enah/Vasp-like | XM_005267749.3 | 98.4% | 98.3% | 1_19delinsA;21C>G |
4 | human | 51466 | EVL | Enah/Vasp-like | XM_011536828.2 | 80.2% | 73.3% | (many diffs) |
5 | human | 51466 | EVL | Enah/Vasp-like | XM_017021363.2 | 79.3% | 65.4% | (many diffs) |
6 | human | 51466 | EVL | Enah/Vasp-like | XR_001750362.1 | 48.4% | (many diffs) | |
7 | human | 51466 | EVL | Enah/Vasp-like | XR_001750364.1 | 35% | (many diffs) | |
8 | human | 51466 | EVL | Enah/Vasp-like | XR_001750366.1 | 34.6% | (many diffs) | |
9 | human | 51466 | EVL | Enah/Vasp-like | XR_001750361.1 | 34.2% | (many diffs) | |
10 | human | 51466 | EVL | Enah/Vasp-like | XR_001750356.1 | 33.9% | (many diffs) | |
11 | human | 51466 | EVL | Enah/Vasp-like | XR_001750359.2 | 33.4% | (many diffs) | |
12 | human | 51466 | EVL | Enah/Vasp-like | XR_001750367.1 | 33.2% | (many diffs) | |
13 | human | 51466 | EVL | Enah/Vasp-like | XR_001750357.2 | 31.5% | (many diffs) | |
14 | human | 51466 | EVL | Enah/Vasp-like | XR_001750360.1 | 29.6% | (many diffs) | |
15 | human | 51466 | EVL | Enah/Vasp-like | XR_001750363.1 | 29.6% | (many diffs) | |
16 | human | 51466 | EVL | Enah/Vasp-like | XR_001750355.1 | 28.7% | (many diffs) | |
17 | human | 51466 | EVL | Enah/Vasp-like | XR_002957557.1 | 28.1% | (many diffs) | |
18 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | NM_001163394.1 | 89.4% | 93.9% | (many diffs) |
19 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | XM_006515471.1 | 88.9% | 93% | (many diffs) |
20 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | XM_006515470.1 | 88% | 92.4% | (many diffs) |
21 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | NM_001163396.2 | 86.4% | 90.8% | (many diffs) |
22 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | NM_007965.3 | 84.4% | 88.9% | (many diffs) |
23 | mouse | 14026 | Evl | Ena-vasodilator stimulated ... | NM_001163395.1 | 83% | 87.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1314
- ORF length:
- 1248
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tgaacagagt atctgccaag cccgggcttc cgtgatggtc tacgatgaca 121 ccagtaagaa atgggtacca atcaaacctg gccagcaggg attcagccgg atcaacatct 181 accacaacac tgccagcaac accttcagag tcgttggagt caagttgcag gatcagcagg 241 ttgtgatcaa ttattcaatc gtgaaagggc tgaagtacaa tcaggccacg ccaaccttcc 301 accagtggcg agatgcccgc caggtctacg gcttaaactt tgcaagtaaa gaagaggcaa 361 ccacgttctc caatgcaatg ctgtttgccc tgaacatcat gaattcccaa gaaggaggcc 421 cctccagcca gcgtcaggtg cagaatggcc cctctcctga tgagatggac atccagagaa 481 gacaagtgat ggagcagcac cagcagcagc gtcaggaatc tctagaaaga agaacctcgg 541 ccacagggcc catcctccca ccaggacatc cttcatctgc agccagcgcc cccgtctcat 601 gtagtgggcc tccaccgccc cccccacccc cagtcccacc tccacccact ggggctaccc 661 cacctccccc acccccactg ccagccggag gagcccaggg gtccagccac gacgagagct 721 ccatgtcagg actggccgct gccatagctg gggccaagct gagaagagtc caacggccag 781 aagacgcatc tggaggctcc agtcccagtg ggacctcaaa gtccgatgcc aaccgggcaa 841 gcagcggggg tggcggagga ggcctcatgg aggaaatgaa caaactgctg gccaagagga 901 gaaaagcagc ctcccagtca gacaagccag ccgagaagaa ggaagatgaa agccaaatgg 961 aagatcctag tacctccccc tctccgggga cccgagcagc cagccagcca cctaactcct 1021 cagaggctgg ccggaagccc tgggagcgga gcaactcggt ggagaagcct gtgtcctcga 1081 ttctgtccag aaccccGTCT GTGGCAAAGA GCCCCGAAGC TAAGAGCCCC CTTCAGTCGC 1141 AGCCTCACTC TAGGATGAAG CCTGCTGGGA GCGTGAATGA CATGGCCCTG GATGCCTTCG 1201 ACTTGGACCG GATGAAGCAG GAGATCCTAG AGGAGGTGGT GAGAGAGCTC CACAAGGTGA 1261 AGGAGGAGAT CATCGACGCC ATCAGGCAGG AGCTGAGTGG GATCAGCACC ACGTACCCAA 1321 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1381 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1441 TATCTTGTGG AAAGGACGAT TTACTACCAG AGTAGATCTT TTTACGCGTT AAGTCgacaa 1501 tcaacctctg gattacaaaa tttgtgaaag att