Transcript: Mouse NM_008037.4

Mus musculus fos-like antigen 2 (Fosl2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fosl2 (14284)
Length:
5886
CDS:
233..1213

Additional Resources:

NCBI RefSeq record:
NM_008037.4
NBCI Gene record:
Fosl2 (14284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008037.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263187 GGTTTGCCAAACGTCTAATTA pLKO_005 2012 3UTR 100% 15.000 21.000 N Fosl2 n/a
2 TRCN0000225639 TGATCACCTCCATGTCCAATC pLKO_005 435 CDS 100% 6.000 8.400 N LOC634417 n/a
3 TRCN0000042688 CGGCACTTCAAACCTTGTCTT pLKO.1 1057 CDS 100% 4.950 6.930 N Fosl2 n/a
4 TRCN0000263184 ATCCACGCTCACATCCCTACA pLKO_005 459 CDS 100% 4.050 5.670 N Fosl2 n/a
5 TRCN0000218343 GACATCACCTGTGGATATTTA pLKO_005 2231 3UTR 100% 15.000 10.500 N LOC634417 n/a
6 TRCN0000225641 ATCACTCCCGGCACTTCAAAC pLKO_005 1049 CDS 100% 10.800 7.560 N LOC634417 n/a
7 TRCN0000225642 CCACACTTCTAGCCCTGTAAC pLKO_005 1194 CDS 100% 10.800 7.560 N LOC634417 n/a
8 TRCN0000042692 CAGCAGAAGTTCCGGGTAGAT pLKO.1 329 CDS 100% 4.950 3.465 N Fosl2 n/a
9 TRCN0000174065 CAGCAGAAGTTCCGGGTAGAT pLKO.1 329 CDS 100% 4.950 3.465 N Fosl2 n/a
10 TRCN0000225640 CCAGACCTGGAGTGATCAAGA pLKO_005 525 CDS 100% 4.950 3.465 N LOC634417 n/a
11 TRCN0000042689 CCAGTCATCAGACTCCTTGAA pLKO.1 1168 CDS 100% 4.950 3.465 N Fosl2 n/a
12 TRCN0000263186 GTGATCACCTCCATGTCCAAT pLKO_005 434 CDS 100% 4.950 3.465 N Fosl2 n/a
13 TRCN0000263185 CACACTTCTAGCCCTGTAACC pLKO_005 1195 CDS 100% 4.050 2.835 N Fosl2 n/a
14 TRCN0000282515 GTCATCAAGCCCATCAGCATC pLKO_005 962 CDS 100% 4.050 2.835 N Fosl2 n/a
15 TRCN0000042691 GAGTGATCAAGACCATCGGTA pLKO.1 534 CDS 100% 2.640 1.848 N Fosl2 n/a
16 TRCN0000042690 GCAGAAAGAGATTGCTGAGCT pLKO.1 730 CDS 100% 2.640 1.848 N Fosl2 n/a
17 TRCN0000016140 GCGCTCTGTCATCAAGCCCAT pLKO.1 955 CDS 100% 0.720 0.504 N FOSL2 n/a
18 TRCN0000353569 GCGCTCTGTCATCAAGCCCAT pLKO_005 955 CDS 100% 0.720 0.504 N FOSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008037.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00587 pDONR223 100% 89.3% 94.8% None (many diffs) n/a
2 ccsbBroad304_00587 pLX_304 0% 89.3% 94.8% V5 (many diffs) n/a
3 TRCN0000472210 TTCATCCTCTCAACCTCCAGTACC pLX_317 47.7% 89.3% 94.8% V5 (many diffs) n/a
Download CSV