Transcript: Mouse NM_008062.2

Mus musculus glucose-6-phosphate dehydrogenase X-linked (G6pdx), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
G6pdx (14381)
Length:
2639
CDS:
348..1895

Additional Resources:

NCBI RefSeq record:
NM_008062.2
NBCI Gene record:
G6pdx (14381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313974 ACGTGGTCCTTGGCCAATATG pLKO_005 1252 CDS 100% 13.200 18.480 N G6pdx n/a
2 TRCN0000041443 GAGGAGTTCTTTGCCCGTAAT pLKO.1 642 CDS 100% 10.800 15.120 N G6pdx n/a
3 TRCN0000317593 GAGGAGTTCTTTGCCCGTAAT pLKO_005 642 CDS 100% 10.800 15.120 N G6pdx n/a
4 TRCN0000314009 TTCACCATCTAACCCTATATT pLKO_005 1958 3UTR 100% 15.000 10.500 N G6pdx n/a
5 TRCN0000041445 GCCACTACAGGTTCAGATGAT pLKO.1 1176 CDS 100% 4.950 3.465 N G6pdx n/a
6 TRCN0000317594 GCCACTACAGGTTCAGATGAT pLKO_005 1176 CDS 100% 4.950 3.465 N G6pdx n/a
7 TRCN0000041444 GAAGAGTTGTACCAGGGTGAT pLKO.1 399 CDS 100% 4.050 2.835 N G6pdx n/a
8 TRCN0000041446 GCCTTCTACCTGAAGATACCT pLKO.1 523 CDS 100% 3.000 2.100 N G6pdx n/a
9 TRCN0000041447 GCTGGATCTAACTTATGGCAA pLKO.1 1604 CDS 100% 2.640 1.584 N G6pdx n/a
10 TRCN0000317522 GCTGGATCTAACTTATGGCAA pLKO_005 1604 CDS 100% 2.640 1.584 N G6pdx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06235 pDONR223 100% 87.5% 93.7% None (many diffs) n/a
2 ccsbBroad304_06235 pLX_304 0% 87.5% 93.7% V5 (many diffs) n/a
3 TRCN0000467117 ATGTGTCCCAATCTGATGCATCTC pLX_317 30.1% 87.5% 93.7% V5 (many diffs) n/a
Download CSV